Advertisement

The interaction between Toll-like receptor 4 signaling pathway and hypoxia-inducible factor 1α in lung ischemia–reperfusion injury

Published:November 25, 2013DOI:https://doi.org/10.1016/j.jss.2013.11.1086

      Abstract

      Background

      Lung ischemia–reperfusion injury (LIRI) is the life-threatening complication occurring after lung transplantation. Toll-like receptor 4 (TLR4) signaling pathway and hypoxia-inducible factor-1α (HIF-1α) are intimately involved in the development and progression of various inflammatory and hypoxia diseases; however, the relationship of them in LIRI in vivo is still far from clear.

      Materials and methods

      Forty-five Sprague–Dawley rats were randomly distributed in nine groups: (1) Sham group, (2) LIRI group, (3) LIRI + saline control group, (4) LIRI + dimethyl Sulfoxide control group, (5) LIRI + lipopolysaccharide group, (6) LIRI + TAK-242 group (TAK-242 is a TLR4 inhibitor, ethyl (6R)-6- [N-(2-chloro-4-fluorophenyl)sulfamoyl]cyclohex-1-ene-1-carboxylate), (7) LIRI + thioredoxin group (thioredoxin is an apoptosis signal–regulating kinase 1 (ASK1) inhibitor), (8) LIRI + SB203580 group (SB203580 is a p38 inhibitor), and (9) LIRI + chetomin group (chetomin is a HIF-1α inhibitor). The interaction between TLR4 signaling pathway (including TLR4, myeloid differentiation primary response gene 88 (MyD88), TIR-domain-containing adapter-inducing interferon-β (TRIF), ASK1, and p38) and HIF-1α and the role of TLR4-dependent HIF-1α were analyzed.

      Results

      In LIRI, HIF-1α accumulation was induced in a TLR4-dependent fashion, and MyD88, but not TRIF, and activation of ASK1 and p38 were found to be critical for TLR4-mediated HIF-1α accumulation. HIF-1α protein played a critical role in TLR4-mediated lung injury of LIRI (including inflammation, cell apoptosis, and lung damage). HIF-1α protein upregulated TLR4 expression of LIRI in a positive feedback manner.

      Conclusions

      We identify that the TLR4-HIF-1 loop may be existed in LIRI. Therefore, we suggest that the interaction between them may represent a novel therapeutic target for the development of novel target-based therapies of LIRI.

      Keywords

      1. Introduction

      Lung transplantation is the only therapeutic option for an increasing number of patients with end-stage pulmonary disease [
      • Christie J.D.
      • Edwards L.B.
      • Aurora P.
      • et al.
      The Registry of the International Society for heart and lung transplantation: twenty-sixth official adult lung and heart-lung transplantation report-2009.
      ]. However, Lung ischemia–reperfusion injury (LIRI) occurs after 20% of lung transplantation and is a major risk factor resulting in primary graft dysfunction with approximately 60% mortality [
      • Lv X.
      • Tan J.
      • Liu D.
      • Wu P.
      • Cui X.
      • et al.
      Intratracheal administration of p38α short-hairpin RNA plasmid ameliorates lung ischemia-reperfusion injury in rats.
      ,
      • de Perrot M.
      • Liu M.
      • Waddell T.K.
      • Keshavjee S.
      Ischemia-reperfusion-induced lung injury.
      ].
      Both hypoxia and inflammation play the important role in a variety of pathologic situations and are closely linked. In inflamed sites, the level of oxygen decreases and the massive metabolic oxygen consumption by surrounding cells leads to more severe hypoxic stress, which further aggravates and accelerates inflammation and tissue damage [
      • Lewis J.S.
      • Lee J.A.
      • Underwood JC.
      • Harris A.L.
      • Lewis C.E.
      Macrophage responses to hypoxia: relevance to disease mechanisms.
      ]. However, the changes of signaling pathway involved in the pathologic process are still poorly studied.
      Toll-like receptor 4 (TLR4) is the mammalian pattern recognition receptor, which recognizes lipopolysaccharide (LPS) as a ligand. Studies of animal models have highlighted that TLR4 signaling respond also to damage-associated molecular patterns that are released by host tissues when exposed to extreme stress conditions [
      • Riva M.
      • Källberg E.
      • Björk P.
      • et al.
      Induction of nuclear factor-κB responses by the S100A9 protein is Toll-like receptor-4-dependent.
      ], such as solid organ transplantation or ischemia–reperfusion injury. TLR4 is intimately involved in the development and progression of various inflammatory diseases [
      • Dhupar R.
      • Klune J.R.
      • Evankovich J.
      • et al.
      Interferon regulatory factor 1 mediates acetylation and release of high mobility group box 1 from hepatocytes during murine liver ischemia-reperfusion injury.
      ]. Hypoxia-inducible factor-1α (HIF-1α) is a major transcription factor of oxygen homeostasis and has been described as the key regulator of hypoxia-induced disease and inflammation pathogenesis [
      • Pugh C.W.
      • Ratcliffe P.J.
      Regulation of angiogenesis by hypoxia: role of the HIF system.
      ]. Recently, some studies demonstrated that TLR4 downstream signaling can lead to the accumulation of HIF-1α, which is important for TLR4-dependent expression of proinflammatory cytokines [
      • Lall H.
      • Coughlan K.
      • Sumbayev V.V.
      HIF-1alpha protein is an essential factor for protection of myeloid cells against LPS-induced depletion of ATP and apoptosis that supports Toll-like receptor 4-mediated production of IL-6.
      ]. In THP-1 human myeloid monocytic leukemia cells, LPS-induced TLR4 signaling triggered cross talk of HIF-1α and apoptosis signal–regulating kinase 1 (ASK1) and ASK1 contributed to the stabilization of HIF-1α, the most likely via activation of p38 mitogen-activated protein (MAP) kinase [
      • Sumbayev V.V.
      LPS-induced Toll-like receptor 4 signalling triggers cross-talk of apoptosis signal-regulating kinase 1 (ASK1) and HIF-1alpha protein.
      ]. ASK1 and p38 are the important downstream signaling molecules of TLR4 signaling pathway. Kim SY et al. [
      • Kim S.Y.
      • Choi Y.J.
      • Joung S.M.
      • Lee B.H.
      • Jung Y.S.
      • Lee J.Y.
      Hypoxic stress up-regulates the expression of Toll-like receptor 4 in macrophages via hypoxia-inducible factor.
      ] reported that TLR4 expression in macrophages was upregulated in response to hypoxic stress via HIF-1α, suggesting that hypoxic stress at sites of inflammation enhances susceptibility to inflammatory signals by upregulating the TLR4.
      In the present study, we have investigated how the interaction between TLR4 signaling pathway (including MyD88, TRIF, ASK1, and p38) and HIF-1α is involved in the development of LIRI in vivo, which has not been examined.

      2. Materials and methods

      2.1 Animals

      All procedures were carried out according to the protocols approved by the Ethics Committee for Animal Experimentation of the Wuxi People's Hospital Affiliated to Nanjing Medical University (Wuxi, Jiangsu, China) and in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Adult male Sprague–Dawley rats (250–300 g) obtained from the Comparative Medicine Centre of Yangzhou University were used in this study.

      2.2 LIRI model

      Rats were anesthetized with 15 g/L continal (60 mg/kg) intraperitoneally. A 14 G angiocatheter was inserted into the trachea through a midline neck incision and secured with a 4-0 braided suture. Tracheotomy allowed mechanical ventilation with a tidal volume of 10 mL/kg, respiratory rate of 70–75 breaths/min, inspiratory-to-expiratory ratio of 0.4, positive end-expiratory pressure of 2 cmH2O, and FiO2 of 1.0 (Inspira 55-7059; Harvard Inspira, Holliston, MA). All animals received 50 U of heparin dissolved in saline (total volume 500 μL) through a penile vein. Five minutes after heparin administration, the pulmonary hilum was occluded, during inspiration, with a noncrushing microvascular clamp, making sure to include the left main bronchus, artery, and vein. The period of ischemia was held constant at 1 h, after which the clamp was removed and the lung reperfused for up to 3 h. Animals were administered with 0.5 mL warm subcutaneous saline per hour to maintain hydration. The heart–lung block was rapidly excised, and the pulmonary circulation was flushed through the main pulmonary artery with 10 mL normal saline. The lungs were then separated from mediastinal tissues. Lungs excised immediately after death served as controls.
      Forty-five rats were randomly divided into nine groups (five rats in each group) and treated as follows: (1) Sham group, (2) LIRI group, (3) LIRI + saline control group (2 mL saline, intravenous injection), (4) LIRI + dimethyl sulfoxide (DMSO) control group (2 mL DMSO, intravenous injection), (5) LIRI + LPS group (1.5 mg LPS diluted in 2 mL saline, intravenous injection), (6) LIRI + TAK-242 group (TAK-242 is a TLR4 inhibitor, 10 mg/kg, diluted in 2 mL DMSO, intravenous injection) [
      • Sha T.
      • Iizawa Y.
      • Ii M.
      Combination of imipenem and TAK-242, a Toll-like receptor 4 signal transduction inhibitor, improves survival in a murine model of polymicrobial sepsis.
      ], (7) LIRI + thioredoxin group (recombinant human thioredoxin is an ASK1 inhibitor, 10 mg/kg, diluted in 2 mL saline, intravenous injection) [
      • Ono R.
      • Masaki T.
      • Dien S.
      • et al.
      Suppressive effect of recombinant human thioredoxin on ultraviolet light-induced inflammation and apoptosis in murine skin.
      ], (8) LIRI + SB203580 group (SB203580 is a P38 inhibitor, 10 mg/kg, diluted in 2 mL DMSO, intravenous injection) [
      • Liu S.
      • Feng G.
      • Wang G.L.
      • Liu G.J.
      p38MAPK inhibition attenuates LPS-induced acute lung injury involvement of NF-kappaB pathway.
      ], and (9) LIRI + chetomin group (chetomin is a HIF-1α inhibitor, 0.5 mg/kg, diluted in 2 mL DMSO, intravenous injection) [
      • Lu H.
      • Li Y.
      • Shu M.Y.
      • et al.
      Hypoxia-inducible factor-1alpha blocks differentiation of malignant gliomas.
      ]. All were intervened 30 min before hilar clamping.

      2.3 Histology

      The lungs were excised and fixed at an airway pressure of 10 cmH2O in 4% paraformaldehyde for 24 h, and embedded in paraffin wax. Sections were cut and stained with hematoxylin and eosin. A histopathologist, blinded for the treatment, histologically assessed the following parameters: intra-alveolar and septal edema, hyaline membrane formation, inflammation (classified as histiocytic, lymphocytic, neutrophilic, or mixed), fibrosis, atelectasis, intra-alveolar hemorrhage, and overall classification. Each parameter was scored as follows: absent, 0; mild, 1; moderate or scattered, 2; or severe or frequent, 3. The pulmonary severity score is the sum of the individual scores of the eight categories, resulting in a possible score ranging from 0 for normal lungs to 24 for the most injured lungs.

      2.4 Terminal deoxynucleotidyl transferase dUTP nick end labeling staining for apoptosis

      Cell apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay using an in situ cell death detection kit (Roche Diagnostics, Mannheim, Germany). Briefly, the prepared sections mentioned previously were incubated with proteinase K, followed by 5 min of incubation in the equilibration buffer, and then they were incubated at 37°C for 1 h in biotinylated deoxyuridine triphosphate and terminal deoxynucleotidyl transferase. The color was developed using Diaminobenzidine. The apoptotic index was a measure of the number of positive cells in each 100 cells counted among five different fields from the same section.

      2.5 Reverse transcription polymerase chain reaction

      Total RNA was prepared from the lung tissue by using Ultrapure RNA kit (CWbio Co, Ltd, Beijing, China) and complementary DNA (cDNA) synthesis was reverse transcribed by using the high-capacity cDNA reverse transcription kit (CWbio.Co Ltd) according to the manufacturer's protocols. cDNA was then amplified with TaqMan gene expression Master Mix and predesigned TaqMan probes for rat TLR4, HIF-1α, interleukin 6 (IL-6), and tumor necrosis factor (TNF-α) as recommended by Applied Biosystems (Carlsbad, CA)(Table 1).
      Table 1Primers used for real-time PCR.
      Primer namePrimer sequence (5′ to 3′)
      TLR4-FGTTCATCTGGGTTTCTGCTG
      TLR4-RTGATTCTTTGCCTGAGTTGC
      HIF1α-FGTTTACTAAAGGACAAGTCACC
      HIF1α-RTTCTGTTTGTTGAAGGGAG
      IL-6-FACTGCCTTCCCTACTTCACA
      IL-6-RTCGCTGTTCATACAATCAGA
      TNF-α-FAAT GGC CTC CCT CAT CAG TT
      TNF-α-RCCA CTT GGT GGT TTG CTA CGA

      2.6 Western blot analysis

      Tissue samples were resolved by sodium dodecyl sulfate poly-acrylamide gel electrophoresis and then transferred to nitrocellulose membranes. The membranes were blocked with 5% nonfat dry milk in Tris-buffered saline for 2 h at room temperature. Thereafter, membranes were incubated with primary antibodies against phospho-ASK1 (P-ASK1; Ser967), phospho-p38 (P-p38; Thr180/Tyr182), total-ASK1, total-p38, cleaved Asp175 caspase-3 (Cellsignal, Danvers, MA), TLR4, MyD88, TRIF, and HIF-1α (Abcam, Cambridge, MA) at 4°C overnight. After being washed three times for 10 min each in TBS-0.05% Tween 20, the membranes were incubated with horseradish peroxidase conjugated secondary antibody for 2 h at room temperature. Specific bands were detected using the Pierce ECL detection system (Thermo-Fischer Scientific, Beijing, China). Band intensities were quantified with ImageJ2x (National Institutes of Health, Bethesda, MD). β-actin was used as an internal control.

      2.7 Statistical analysis

      All values are expressed as mean ± standard deviation or Standard error of the mean. Groups were compared by analysis of variance with Tukey post hoc test using GraphPad Prism (GraphPad Software, Inc., La Jolla, CA). A P value <0.05 was considered statistically significant.

      3. Results

      3.1 In LIRI, accumulation of HIF-1α in vivo is induced in a TLR4-dependent fashion

      We measured the change of HIF-1α expression after regulating TLR4 signaling by using LPS and TAK-242. LPS is a microbial activator of TLR4 and TAK-242 is a TLR4 inhibitor. We found that LPS further enhanced messenger RNA (mRNA) and accumulation of HIF-1α and TAK-242 substantially inhibited the expression of them compared with the LIRI group (Fig. 1A and B).
      Figure thumbnail gr1
      Fig. 1The involvement of TLR4 signaling pathway in accumulation of HIF-1α in LIRI. (A) MyD88, TRIF, P-ASK1, P-p38, and HIF-1α were detected by Western blot analysis. The expression of MyD88, P-ASK1, P-p38, and HIF-1α of the LIRI group were significantly higher than the sham group simultaneously. Furthermore, LPS and TAK-242 markedly mediated their expression compared with the LIRI group. (B) Both of HIF-1α mRNA and protein were induced in a TLR4-dependent fashion. (C) The increased P-p38 and HIF-1α of the LIRI group were reduced by thioredoxin treatment. (D) By blocking p38 activity, HIF-1α was further reduced compared with LIRI group. Digital data are mean values ± standard deviation. *P < 0.05 versus the LIRI group.

      3.2 MyD88 signaling, instead of TRIF, may be critical for TLR4-mediated HIF-1α accumulation in LIRI, in which ASK1 and p38 activation is involved

      To understand the role of MyD88 and TRIF (two different TLR4 signaling downstream) in TLR4-mediated HIF-1α accumulation in LIRI, we measured MyD88 and TRIF expression and ASK1 and P38 activation by Western blot analysis. We found that MyD88 expression, P-ASK1, and P-p38 were significantly higher in the LIRI group in comparison with the sham group simultaneously. Furthermore, LPS markedly enhanced the expression of MyD88, P-ASK1 and P-p38 and TAK-242 dramatically reduced their expression when compared with the LIRI group alone (Fig. 1A), whereas total-ASK1 and total-p38 were identical (not shown in the figure). TRIF expression did not be impacted in the process, suggesting that TRIF may not react to the TLR4-mediated effect and be not involved in this process (Fig. 1A).
      Further analysis was performed by using recombinant human thioredoxin (an ASK1 inhibitor). Western blot analysis confirmed the increased P-p38, and HIF-1α expression of the LIRI group was suppressed by thioredoxin treatment (Fig. 1C). To further confirm the role of p38 in HIF-1α accumulation, SB203580 was used to block the p38 activity. We found that HIF-1α expression was significantly reduced when compared with the LIRI group (Fig. 1D). The results indicated that accumulation of HIF-1α is induced in the LIRI group via ASK1 and P38 activation.

      3.3 In LIRI, HIF-1α may play a critical role in TLR4-mediated productions of inflammatory cytokine (TNF-α and IL-6), apoptosis (examined by cleaved caspase-3 expression and TUNEL staining) and pulmonary severity score of lung injury

      Comparing with the LIRI group, inflammatory responses and apoptosis were markedly attenuated by chetomin (a HIF-1α inhibitor), showed by the levels of inflammatory cytokines (TNF-α and IL-6) (Fig. 2A), cleaved caspase-3 expression (an active apoptosis-regulating molecule) (Fig. 2B) and TUNEL-positive cells (Fig. 2C and E), suggesting that HIF-1α significantly affects the inflammation and cell apoptosis of LIRI.
      Figure thumbnail gr2
      Fig. 2HIF-1α plays a critical role in TLR4-mediated inflammatory and injury in LIRI in vivo. Comparing with the LIRI group, inflammatory cytokines (TNF-α and IL-6) (A), cleaved caspase-3 (caspase-3 active form) (B), and TUNEL-positive cells (C and E) were markedly attenuated by chetomin (a HIF-1α inhibitor). (D) In the LIRI group, diffuse alveolar damage, characterized by inflammation, moderate to severe septal edema, intra-alveolar hemorrhages, atelectasis, and congestion were appeared. HIF-1α inhibitor caused less septal edema and inflammation, although mild atelectasis and intra-alveolar hemorrhage were still present. The histologic severity score became significantly lower after treatment with the HIF-1α inhibitor (D and F). Digital data are mean values ± standard deviation. *P < 0.05 versus the LIRI group. (Color version of figure is available online.)
      In the LIRI group, diffuse alveolar damage, characterized by inflammation, moderate to severe septal edema, intra-alveolar hemorrhages, atelectasis, and congestion were appeared. In the LIRI + chetomin group, HIF-1α inhibition caused less septal edema and inflammation, although mild atelectasis and intra-alveolar hemorrhage were still present (Fig. 2C) when compared with the LIRI group. The histologic severity score of the LIRI group became significantly lower after treatment with the HIF-1α inhibitor (Fig. 2D and F; Table 2), suggesting that HIF-1α significantly affects the lung injury of LIRI. Being consistent with HIF-1α, blockade alone of ASK-1 and p-38 also improved the histologic severity scores of LIRI (not shown in the figure).
      Table 2Histologic severity score of the lung.
      GroupSeverity score Mean ± SEM
      Sham2.40 ± 0.24
      LIRI9.60 ± 0.40
      LIRI + DMSO9.00 ± 0.71
      LIRI + chetomin4.40 ± 0.25
      P < 0.05 versus LIRI.
      SEM = Standard error of the mean.
      P < 0.05 versus LIRI.

      3.4 HIF-1α may upregulate TLR4 expression of LIRI in a feedback manner

      To investigate the effect of HIF-1α on TLR4 signaling in LIRI, TLR4 expression of the LIRI + chetomin group was examined. The consequence was that TLR4 mRNA and protein levels were significantly reduced indicating that HIF-1α may play an important effect on TLR4 signaling in a positive feedback manner (Fig. 3).
      Figure thumbnail gr3
      Fig. 3The LIRI model treated with chetomin (a HIF-1α inhibitor) showed that TLR4 mRNA (B) and protein (A, B) levels were significantly reduced. Digital data are mean values ± standard deviation. *P < 0.05 compared with the LIRI group.

      4. Discussion

      TLR4 is one of the most physiologically important TLRs, which recognizes LPS as a ligand and induces activation of downstream signaling networks that initiating innate immune signaling cascades and proinflammatory responses [
      • Liu H.
      • Xu R.
      • Feng L.
      • et al.
      A novel chromone derivative with anti-inflammatory property via inhibition of ROS-dependent activation of TRAF6-ASK1-p38 pathway.
      ]. HIF-1α is the major transcription factor of oxygen homeostasis and a key regulator of hypoxia-induced disease and inflammation pathogenesis [
      • Song Z.C.
      • Zhou W.
      • Shu R.
      • Ni J.
      Hypoxia induces apoptosis and autophagic cell death in human periodontal ligament cells through HIF-1α pathway.
      ]. In the present study, we found that, in rat LIRI model in vivo, TLR4 downstream signaling could induce HIF-1α expression and activation and TLR4 expression was mediated by HIF-1α, indicating that the TLR4-HIF-1 loop may be exist in LIRI. To our knowledge, this was the first study demonstrating the interaction between TLR4 signaling pathway and HIF-1α in LIRI.
      TLR4 signaling downstream of receptor activation involves recruitment of adapter proteins including MyD88 and TRIF [
      • O'Neill L.A.
      • Bowie A.G.
      The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling.
      ]. MyD88 signaling is the key adapter downstream of TLR4. MyD88-dependent signaling is associated with HIF-1α activation in a murine wound-healing model [
      • Macedo L.
      • Pinhal-Enfield G.
      • Alshits V.
      • Elson G.
      • Cronstein B.N.
      • Leibovich S.J.
      Wound healing is impaired in MyD88-deficient mice: a role for MyD88 in the regulation of wound healing by adenosine A2A receptors.
      ]. Furthermore, it has been demonstrated that MyD88 is necessary to stabilize HIF-1α under normoxic conditions in a human monocytic cell line after stimulation with LPS [
      • Spirig R.
      • Djafarzadeh S.
      • Regueira T.
      • et al.
      Effects of TLR agonists on the hypoxia-regulated transcription factor HIF-1alpha and dendritic cell maturation under normoxic conditions.
      ]. Our results indicate that MyD88-dependent TLR4 signaling is a critical component of HIF-1α activation in LIRI and TRIF is not involved. The present study is the first one to study the change of TRIF in LIRI.
      How MyD88-dependent TLR4 signaling activates HIF-1α? ASK1 and p38 are considered to be involved. ASK1 is an evolutionarily conserved MAP 3-kinase and an active form of the kinase interacts with tumor necrosis factor receptor associated factor 6 forming catalytically active complex that activates p38 MAP kinases. ASK1 is required for the induction of proinflammatory cytokines dependent on TLR4 [
      • Matsuzawa A.
      • Saegusa K.
      • Noguchi T.
      • et al.
      ROS-dependent activation of the TRAF6-ASK1-p38 pathway is selectively required for TLR4-mediated innate immunity.
      ]. In THP-1 cells, there is evidence concerning involvement of ASK1-p38 cascade in LPS-dependent accumulation of HIF-1α protein. Transfection of THP-1 cells with dominant-negative isoform of ASK1 has been shown to attenuate LPS-induced HIF-1α accumulation. The same effect was observed when the cells were pretreated with p38 MAP kinase inhibitor SB203580 before 4 h of exposure to LPS [
      • Nicholas S.A.
      • Sumbayev V.V.
      The role of redox-dependent mechanisms in the downregulation of ligand-induced Toll-like receptors 7, 8 and 4-mediated HIF-1 alpha prolyl hydroxylation.
      ]. To investigate the role of ASK1-p38 in TLR4-mediated HIF-1α of LIRI, P-ASK1 and P-p38 activation and HIF-1α protein were detected. We found that the expression of the LIRI group was significantly higher than the sham group simultaneously. Furthermore, LPS and TAK-242 (a TLR4 inhibitor) markedly mediated their expression compared with the LIRI group alone. Then recombinant human thioredoxin (a ASK1 inhibitor) and SB203580 (a P38 inhibitor) were used confirming that ASK1 and p38 activation are involved in TLR4-mediated HIF-1α of LIRI. We therefore suggest that TLR4 signaling leads to accumulation of HIF-1α by ASK1-activated p38 in LIRI.
      HIF-1α has been considered as a critical determinant in the pathophysiological response to hypoxia-ischemia in conditions, and its activation is an early reperfusion-independent event of the inflammatory response [
      • Hierholzer C.
      • Harbrecht B.G.
      • Billiar T.R.
      • Tweardy D.J.
      Hypoxia-inducible factor-1 activation and cyclo-oxygenase-2 induction are early reperfusion-independent inflammatory events in hemorrhagic shock.
      ]. HIF-1α is known to have a critical role in TLR downstream signaling by promoting energy metabolism, proinflammatory responses and pro-apoptosis [
      • Nicholas S.A.
      • Sumbayev V.V.
      The role of redox-dependent mechanisms in the downregulation of ligand-induced Toll-like receptors 7, 8 and 4-mediated HIF-1 alpha prolyl hydroxylation.
      ]. Peyssonnaux C et al. [
      • Peyssonnaux C.
      • Cejudo-Martin P.
      • Doedens A.
      • Zinkernagel A.S.
      • Johnson R.S.
      • Nizet V.
      Cutting edge: essential role of hypoxia inducible factor-1alpha in development of lipopolysaccharide-induced sepsis.
      ] showed that TLR4-dependent HIF-1α could promote the production of inflammatory cytokines in the host during early sepsis. HIF-1α deletion in macrophages attenuated LPS-dependent production of inflammatory cytokines and was protective against mortality. Inhibition of HIF-1α activity may thus represent a novel therapeutic target for LPS-induced sepsis [
      • Peyssonnaux C.
      • Cejudo-Martin P.
      • Doedens A.
      • Zinkernagel A.S.
      • Johnson R.S.
      • Nizet V.
      Cutting edge: essential role of hypoxia inducible factor-1alpha in development of lipopolysaccharide-induced sepsis.
      ]. In the present study, the similar role of TLR4-dependent HIF-1α in the LIRI model was observed.
      In the context of ischemic injury, HIF-1α is originally shown to protect organs that are highly sensitive to energy deprivation such as the brain, heart, and kidney from ischemic damage in ischemia–reperfusion injury preconditioning models [
      • Fraisl P.
      • Aragonés J.
      • Carmeliet P.
      Inhibition of oxygen sensors as a therapeutic strategy for ischaemic and inflammatory disease.
      ]. Thus, one accepted role for HIF-1α is that it acts as an adaptive and survival factor for cells exposed to hypoxia or cells undergoing stress such as ischemic injury, especially in models of ischemic preconditioning [
      • Fraisl P.
      • Aragonés J.
      • Carmeliet P.
      Inhibition of oxygen sensors as a therapeutic strategy for ischaemic and inflammatory disease.
      ,
      • Loor G.
      • Schumacker P.T.
      Role of hypoxia-inducible factor in cell survival during myocardial ischemia-reperfusion.
      ]. In fact, the role of HIF-1α, as protective or deleterious, may depend on the physiological context of the model and whether the insult is acute or chronic [
      • Feinman R.
      • Deitch E.A.
      • Watkins A.C.
      • et al.
      HIF-1 mediates pathogenic inflammatory responses to intestinal ischemia-reperfusion injury.
      ]. In response to prolonged ischemic stress and in various nonpreconditioning models, HIF-1α may be deleterious because of its ability to augment both apoptotic and inflammatory processes, especially via upregulation of inducible nitric oxide synthase [
      • Bakker W.J.
      • Harris I.S.
      • Mak T.W.
      FOXO3a is activated in response to hypoxic stress and inhibits HIF1-induced apoptosis via regulation of CITED2.
      ,
      • Dehne N.
      • Brüne B.
      HIF-1 in the inflammatory microenvironment.
      ] or by other secondary harmful injury factors, such as inflammatory processes and TLR4 signaling, instead of ischemia [
      • Koury J.
      • Deitch E.A.
      • Homma H.
      • et al.
      Persistent HIF-1alpha activation in gut ischemia/reperfusion injury: potential role of bacteria and lipopolysaccharide.
      ,
      • Huang L.E.
      • Gu J.
      • Schau M.
      • Bunn H.F.
      Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway.
      ]. Recent studies have demonstrated that increased caspase-3 protein and activity are regulated by HIF-1α activation via inducible nitric oxide synthase [
      • Feinman R.
      • Deitch E.A.
      • Watkins A.C.
      • et al.
      HIF-1 mediates pathogenic inflammatory responses to intestinal ischemia-reperfusion injury.
      ]. Some studies showed that a functional HIF-1α response element was present within the caspase-3 promoter [
      • Peng Y.J.
      • Yuan G.
      • Ramakrishnan D.
      • et al.
      Heterozygous HIF-1alpha deficiency impairs carotid body-mediated systemic responses and reactive oxygen species generation in mice exposed to intermittent hypoxia.
      ]. These findings suggest that HIF-1α activation may contribute to impaired organ function by promoting cell death. Our data showed that HIF-1α significantly affects inflammation, lung damage, and cell apoptosis in LIRI. Our findings suggest that accumulation of HIF-1α may play a critical deleterious, but not protective, role in TLR4-mediated inflammatory and injury of LIRI in vivo. Being consistent with HIF-1α, ASK-1 and p-38 alone also affect the histologic severity scores of LIRI, confirming that these two proteins are the mediators of the HIF1α effect in LIRI and really close the loop (ASK-1-p38- HIF-1α).
      The present study is the first one to observe the role of HIF-1α in mediating TLR4 expression of LIRI in a positive feedback manner. Murine macrophages exposed to hypoxic stress showed enhanced responsiveness to LPS and upregulation of TLR4 mRNA and protein expression induced by hypoxia or CoCl2 was significantly attenuated when HIF-1α expression was knocked down by small interfering RNA. The results of chromatin immunoprecipitation assays in murine macrophages showed that HIF-1 could transcriptionally regulate TLR4 expression under hypoxic conditions by direct binding to the TLR4 promoter region. A study demonstrated that PI3 K/Akt contributed to hypoxic stress-induced TLR4 expression at least partly through the regulation of HIF-1 activation [
      • Kim S.Y.
      • Jeong E.
      • Joung S.M.
      • Lee J.Y.
      PI3K/Akt contributes to increased expression of Toll-like receptor 4 in macrophages exposed to hypoxic stress.
      ]. Our data showed that TLR4 mRNA and protein in vivo was regulated by HIF-1α accumulation in LIRI, indicating the interaction between TLR4 signaling pathway and HIF-1α, or the TLR4-HIF-1 loop, may be existed in LIRI.

      5. Conclusions

      In summary, our study highlights the interaction between TLR4 signaling pathway and HIF-1α in vivo of LIRI. In LIRI, HIF-1α is activated by TLR4 signing, MyD88, ASK1, and p38 are involved, and TLR4-mediated HIF-1α contributes to inflammation, cell apoptosis, and lung damage. Accumulation of HIF-1α mediates TLR4 expression of LIRI in a positive feedback manner. The TLR4-HIF-1 loop may be existed in LIRI. To our knowledge, there has been no previous report on this subject in LIRI. Our study suggests that the TLR4-HIF-1 loop may represent a novel therapeutic target for the development of novel target-based therapies of LIRI.

      References

        • Christie J.D.
        • Edwards L.B.
        • Aurora P.
        • et al.
        The Registry of the International Society for heart and lung transplantation: twenty-sixth official adult lung and heart-lung transplantation report-2009.
        J Heart Lung Transplant. 2009; 28: 1031
        • Lv X.
        • Tan J.
        • Liu D.
        • Wu P.
        • Cui X.
        • et al.
        Intratracheal administration of p38α short-hairpin RNA plasmid ameliorates lung ischemia-reperfusion injury in rats.
        J Heart Lung Transplant. 2012; 31: 655
        • de Perrot M.
        • Liu M.
        • Waddell T.K.
        • Keshavjee S.
        Ischemia-reperfusion-induced lung injury.
        Am J Respir Crit Care Med. 2003; 167: 490
        • Lewis J.S.
        • Lee J.A.
        • Underwood JC.
        • Harris A.L.
        • Lewis C.E.
        Macrophage responses to hypoxia: relevance to disease mechanisms.
        J Leukoc Biol. 1999; 66: 889
        • Riva M.
        • Källberg E.
        • Björk P.
        • et al.
        Induction of nuclear factor-κB responses by the S100A9 protein is Toll-like receptor-4-dependent.
        Immunology. 2012; 137: 172
        • Dhupar R.
        • Klune J.R.
        • Evankovich J.
        • et al.
        Interferon regulatory factor 1 mediates acetylation and release of high mobility group box 1 from hepatocytes during murine liver ischemia-reperfusion injury.
        Shock. 2011; 35: 293
        • Pugh C.W.
        • Ratcliffe P.J.
        Regulation of angiogenesis by hypoxia: role of the HIF system.
        Nat Med. 2003; 9: 677
        • Lall H.
        • Coughlan K.
        • Sumbayev V.V.
        HIF-1alpha protein is an essential factor for protection of myeloid cells against LPS-induced depletion of ATP and apoptosis that supports Toll-like receptor 4-mediated production of IL-6.
        Mol Immunol. 2008; 45: 3045
        • Sumbayev V.V.
        LPS-induced Toll-like receptor 4 signalling triggers cross-talk of apoptosis signal-regulating kinase 1 (ASK1) and HIF-1alpha protein.
        FEBS Lett. 2008; 582: 319
        • Kim S.Y.
        • Choi Y.J.
        • Joung S.M.
        • Lee B.H.
        • Jung Y.S.
        • Lee J.Y.
        Hypoxic stress up-regulates the expression of Toll-like receptor 4 in macrophages via hypoxia-inducible factor.
        Immunology. 2010; 129: 516
        • Sha T.
        • Iizawa Y.
        • Ii M.
        Combination of imipenem and TAK-242, a Toll-like receptor 4 signal transduction inhibitor, improves survival in a murine model of polymicrobial sepsis.
        Shock. 2011; 35: 205
        • Ono R.
        • Masaki T.
        • Dien S.
        • et al.
        Suppressive effect of recombinant human thioredoxin on ultraviolet light-induced inflammation and apoptosis in murine skin.
        J Dermatol. 2012; 39: 843
        • Liu S.
        • Feng G.
        • Wang G.L.
        • Liu G.J.
        p38MAPK inhibition attenuates LPS-induced acute lung injury involvement of NF-kappaB pathway.
        Eur J Pharmacol. 2008; 584: 159
        • Lu H.
        • Li Y.
        • Shu M.Y.
        • et al.
        Hypoxia-inducible factor-1alpha blocks differentiation of malignant gliomas.
        FEBS J. 2009; 276: 7291
        • Liu H.
        • Xu R.
        • Feng L.
        • et al.
        A novel chromone derivative with anti-inflammatory property via inhibition of ROS-dependent activation of TRAF6-ASK1-p38 pathway.
        PLoS One. 2012; 7: e37168
        • Song Z.C.
        • Zhou W.
        • Shu R.
        • Ni J.
        Hypoxia induces apoptosis and autophagic cell death in human periodontal ligament cells through HIF-1α pathway.
        Cell Prolif. 2012; 45: 239
        • O'Neill L.A.
        • Bowie A.G.
        The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling.
        Nat Rev Immunol. 2007; 7: 353
        • Macedo L.
        • Pinhal-Enfield G.
        • Alshits V.
        • Elson G.
        • Cronstein B.N.
        • Leibovich S.J.
        Wound healing is impaired in MyD88-deficient mice: a role for MyD88 in the regulation of wound healing by adenosine A2A receptors.
        Am J Pathol. 2007; 171: 1774
        • Spirig R.
        • Djafarzadeh S.
        • Regueira T.
        • et al.
        Effects of TLR agonists on the hypoxia-regulated transcription factor HIF-1alpha and dendritic cell maturation under normoxic conditions.
        PLoS One. 2010; 5: e0010983
        • Matsuzawa A.
        • Saegusa K.
        • Noguchi T.
        • et al.
        ROS-dependent activation of the TRAF6-ASK1-p38 pathway is selectively required for TLR4-mediated innate immunity.
        Nat Immunol. 2005; 6: 587
        • Nicholas S.A.
        • Sumbayev V.V.
        The role of redox-dependent mechanisms in the downregulation of ligand-induced Toll-like receptors 7, 8 and 4-mediated HIF-1 alpha prolyl hydroxylation.
        Immunol Cell Biol. 2010; 88: 180
        • Hierholzer C.
        • Harbrecht B.G.
        • Billiar T.R.
        • Tweardy D.J.
        Hypoxia-inducible factor-1 activation and cyclo-oxygenase-2 induction are early reperfusion-independent inflammatory events in hemorrhagic shock.
        Arch Orthop Trauma Surg. 2001; 121: 219
        • Peyssonnaux C.
        • Cejudo-Martin P.
        • Doedens A.
        • Zinkernagel A.S.
        • Johnson R.S.
        • Nizet V.
        Cutting edge: essential role of hypoxia inducible factor-1alpha in development of lipopolysaccharide-induced sepsis.
        J Immunol. 2007; 178: 7516
        • Fraisl P.
        • Aragonés J.
        • Carmeliet P.
        Inhibition of oxygen sensors as a therapeutic strategy for ischaemic and inflammatory disease.
        Nat Rev Drug Discov. 2009; 8: 139
        • Loor G.
        • Schumacker P.T.
        Role of hypoxia-inducible factor in cell survival during myocardial ischemia-reperfusion.
        Cell Death Differ. 2008; 15: 686
        • Feinman R.
        • Deitch E.A.
        • Watkins A.C.
        • et al.
        HIF-1 mediates pathogenic inflammatory responses to intestinal ischemia-reperfusion injury.
        Am J Physiol Gastrointest Liver Physiol. 2010; 299: G833
        • Bakker W.J.
        • Harris I.S.
        • Mak T.W.
        FOXO3a is activated in response to hypoxic stress and inhibits HIF1-induced apoptosis via regulation of CITED2.
        Mol Cell. 2007; 28: 941
        • Dehne N.
        • Brüne B.
        HIF-1 in the inflammatory microenvironment.
        Exp Cell Res. 2009; 315: 1791
        • Koury J.
        • Deitch E.A.
        • Homma H.
        • et al.
        Persistent HIF-1alpha activation in gut ischemia/reperfusion injury: potential role of bacteria and lipopolysaccharide.
        Shock. 2004; 22: 270
        • Huang L.E.
        • Gu J.
        • Schau M.
        • Bunn H.F.
        Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway.
        Proc Natl Acad Sci U S A. 1998; 95: 7987
        • Peng Y.J.
        • Yuan G.
        • Ramakrishnan D.
        • et al.
        Heterozygous HIF-1alpha deficiency impairs carotid body-mediated systemic responses and reactive oxygen species generation in mice exposed to intermittent hypoxia.
        J Physiol. 2006; 577: 705
        • Kim S.Y.
        • Jeong E.
        • Joung S.M.
        • Lee J.Y.
        PI3K/Akt contributes to increased expression of Toll-like receptor 4 in macrophages exposed to hypoxic stress.
        Biochem Biophys Res Commun. 2012; 419: 466