Advertisement

Complete Freund’s adjuvant–induced acute inflammatory pain could be attenuated by triptolide via inhibiting spinal glia activation in rats

Published:November 25, 2013DOI:https://doi.org/10.1016/j.jss.2013.11.1087

      Abstract

      Background

      Inflammatory pain is one of the most common clinical symptoms, mechanical allodynia and thermal hypersensitivities are associated with proinflammatory cytokines, and proinflammatory cytokine antagonists could alleviate the hypersensitivity. Previous studies showed that a traditional Chinese medicine ingredient, triptolide could inhibit inflammatory cytokines; however, it was still unknown whether triptolide had beneficial effects on treating inflammatory pain.

      Materials and methods

      The effects of triptolide on Complete Freund's Adjuvant–induced acute inflammatory pain were investigated using behavioral tests. The activation of spinal glia was morphologically observed by immunofluorescent histochemistry. The levels of OX42, glia fibrillary acidic protein, and phosphorylated extracellular signal–regulated kinase in the spinal cord were detected by Western blot, and the messenger RNA levels of interleukin 1β, interleukin 6, and tumor necrosis factor alpha were detected by real-time polymerase chain reaction.

      Results

      These results demonstrate that the triptolide effectively attenuates inflammatory pain induced by Complete Freund's Adjuvant, the underlying mechanism may regulate the phosphorylated extracellular signal–regulated kinase signaling pathway and inhibit the spinal glia activation, and then downregulate the proinflammatory cytokines; the triptolide may be clinically useful as a drug of anti-inflammatory pain.

      Conclusions

      In the present study, we first reported that repeated systemic administration of triptolide could safely prevent and reverse inflammatory pain. The triptolide may serve as a new potential compound for developing safe therapeutics for patients suffering inflammatory pain.

      Keywords

      1. Introduction

      Pain followed tissue lesions is one of the most common clinical symptoms, including bone fracture, peripheral neuropathy, and so forth. Acute inflammatory pain is much suffering and turned to be intractable also poor of effective treatment [
      • Okuda K.
      • Takeshima N.
      • Hagiwara S.
      • et al.
      New anthranilic acid derivative, EAntS-GS, attenuates Freund's complete adjuvant-induced acute pain in rats.
      ]. Inflammatory pain produces mechanical allodynia and thermal hypersensitivity, which could be related to the inflammatory mediators released from inflammatory or adjacent tissues; patients presented to be decreased pain threshold and increased response to stimulus, resulting in nociception [
      • Kiguchi N.
      • Maeda T.
      • Kobayashi Y.
      • et al.
      Involvement of inflammatory mediators in neuropathic pain caused by vincristine.
      ,
      • Sun S.
      • Yin Y.
      • Yin X.
      • et al.
      Anti-nociceptive effects of Tanshinone IIA (TIIA) in a rat model of complete Freund's adjuvant (CFA)-induced inflammatory pain.
      ]. But the peripheral factors were not enough for expliciting the hypersensitivity of acute inflammatory pain; the release of a series of chemical signals would alter the threshold of nociceptors [
      • Kidd B.L.
      • Urban L.A.
      Mechanisms of inflammatory pain.
      ] and the excitability of spinal neurons [
      • Ji R.R.
      • Woolf C.J.
      Neuronal plasticity and signal transduction in nociceptive neurons: implications for the initiation and maintenance of pathological pain.
      ]. Mechanical allodynia and thermal hypersensitivities are associated with proinflammatory cytokines, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β [
      • Iwatsuki K.
      • Arai T.
      • Ota H.
      • et al.
      Targeting anti-inflammatory treatment can ameliorate injury-induced neuropathic pain.
      ,
      • Verri Jr., W.A.
      • Cunha T.M.
      • Parada C.A.
      • et al.
      Hypernociceptive role of cytokines and chemokines: targets for analgesic drug development?.
      ], and proinflammatory cytokine antagonists could alleviate the hypersensitivity [
      • Okamoto T.
      • Iwata S.
      • Ohnuma K.
      • et al.
      Histamine H1-receptor antagonists with immunomodulating activities: potential use for modulating T helper type 1 (Th1)/Th2 cytokine imbalance and inflammatory responses in allergic diseases.
      ,
      • Standiford T.J.
      Anti-inflammatory cytokines and cytokine antagonists.
      ]. The suppression of proinflammatory cytokines can partially reduce inflammation; although these drugs are currently available for clinical use, they are not highly effective and have significant side effects [
      • Mendell J.R.
      • Sahenk Z.
      Clinical practice. Painful sensory neuropathy.
      ,
      • Minami M.
      • Katayama T.
      • Satoh M.
      Brain cytokines and chemokines: roles in ischemic injury and pain.
      ]. Many plants and their compounds used in traditional medicine might be useful in alleviating inflammation and inflammatory pain [
      • Calixto J.B.
      • Otuki M.F.
      • Santos A.R.
      Anti-inflammatory compounds of plant origin. Part I. Action on arachidonic acid pathway, nitric oxide and nuclear factor kappa B (NF-kappaB).
      ,
      • Calixto J.B.
      • Campos M.M.
      • Otuki M.F.
      • et al.
      Anti-inflammatory compounds of plant origin. Part II. Modulation of pro-inflammatory cytokines, chemokines and adhesion molecules.
      ]. As a traditional Chinese medicine, The Tripterygium wilfordii Hook. f. often used for treating inflammatory diseases [
      • Qiu D.
      • Kao P.N.
      Immunosuppressive and anti-inflammatory mechanisms of triptolide, the principal active diterpenoid from the Chinese medicinal herb Tripterygium wilfordii Hook. f.
      ], which is a vine-like member of the celastraceae plant family, and triptolide was the major active ingredient. Previous studies have shown that the triptolide could inhibit TNF-α, IL-1β, and nitric oxide production in microglia [
      • Qiu D.
      • Kao P.N.
      Immunosuppressive and anti-inflammatory mechanisms of triptolide, the principal active diterpenoid from the Chinese medicinal herb Tripterygium wilfordii Hook. f.
      ]. The triptolide could effectively protect neurons from inflammatory damage through inhibiting microglial activation [
      • Li F.Q.
      • Lu X.Z.
      • Liang X.B.
      • et al.
      Triptolide, a Chinese herbal extract, protects dopaminergic neurons from inflammation-mediated damage through inhibition of microglial activation.
      ]. These data indicated that triptolide could significantly repress the immune response; however, it was still unknown whether triptolide had beneficial effects in treating inflammatory pain especially the acute ones. In the present study, we tested the triptolide-inhibited hypersensitivity and further tried to explore the underlying mechanism.

      2. Materials and methods

      2.1 Animals

      Male Sprague Dawley rats (180–220 g) were used in the study; rats were housed in a temperature-controlled environment at 22°C–25°C and 12-h light/dark cycle. The animals were free to food and water. The Animal Care and Use Program is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care, International. The minimum number of animals were used to demonstrate consistent effects.
      The study was approved by the Ethical Committee of Animal Research at the PLA 302 Hospital, Beijing, China. All experiments were conducted in accordance with the Institutional Committee for the Care and Use of Animals and guidelines from the Ethical Standards for Investigations of Experimental Pain in Conscious Animals [
      • Zimmermann M.
      Ethical guidelines for investigations of experimental pain in conscious animals.
      ] and the International Association for the Study of Pain.

      2.2 Drug injection

      Thirty-six rats were randomly divided into six groups: saline, saline + triptolide (T), saline + U0126, Complete Freund's adjuvant (CFA), CFA + T, and CFA + U0126 (n = 6 for each group). The rats in the CFA and CFA + T groups were subcutaneously injected with 150 μL of CFA (Sigma, St. Louis, MO) in the plantar surface of the right hind paw while under light ether anesthesia. The CFA injection immediately induces local inflammation, paw swelling, and pain, which persist for at least 2 wk after injection [
      • Chang M.
      • Smith S.
      • Thorpe A.
      • et al.
      Evaluation of phenoxybenzamine in the CFA model of pain following gene expression studies and connectivity mapping.
      ]. The 18 rats in the saline, saline + T, and saline + U0126 groups were injected with 150 μL of physiological saline under identical conditions. The rats in the saline + T and CFA + T groups were treated with triptolide (100 μg/kg) during the period of day 2 (2 d before CFA injection) to day 7 (7 d after injection) [
      • Wang W.
      • Mei X.P.
      • Chen L.
      • et al.
      Triptolide prevents and attenuates neuropathic pain via inhibiting central immune response.
      ]. The rats in the saline + U0126 and CFA + U0126 groups were parallelly treated by intraperitoneal injection of U0126 (300 mg/kg; Sigma). The rats in the CFA and saline control groups were intraperitoneally injected with same amount of saline.

      2.3 Behavioral tests

      2.3.1 Paw withdraw latency in response to noxious thermal stimuli

      Paw withdraw latency (PWL) in response to noxious thermal stimuli was assessed using an RTY-3 radiant heat stimulator (Xi'an Fenglan Instrumental Factory, Xi'an, China) by those blinded to the group assignments [
      • Sun S.
      • Yin Y.
      • Yin X.
      • et al.
      Anti-nociceptive effects of Tanshinone IIA (TIIA) in a rat model of complete Freund's adjuvant (CFA)-induced inflammatory pain.
      ]. This device produces radiant heat by directing a beam of light to the plantar surface of the hind paw; the light is extinguished on paw withdrawal. The rats were placed in plastic boxes on a glass plate for at least 30 min before testing. The time from initiation of the light beam to paw withdrawal was noted as PWL. Three trials on the same paw were performed with intervals of at least 5 min. To prevent tissue damage, radiant heat was administered for a maximum of 20 s. The rats were habituated to the testing environment for 3 d before baseline testing. The rats were tested on two successive days before CFA injection to determine a baseline value for each animal. The PWLs were then tested at 2, 6, 12, and 24 h and 2–7 d after CFA injection.

      2.3.2 Mechanical hypersensitivity

      The protocol used was similar to the published reports [
      • Wang W.
      • Wang W.
      • Mei X.
      • et al.
      Crosstalk between spinal astrocytes and neurons in nerve injury-induced neuropathic pain.
      ,
      • Wang W.
      • Mei X.P.
      • Wei Y.Y.
      • et al.
      Neuronal NR2B-containing NMDA receptor mediates spinal astrocytic c-Jun N-terminal kinase activation in a rat model of neuropathic pain.
      ]. Mechanical hypersensitivity was assessed using calibrated von Frey filaments (Stoelting, Kiel, WI) by those blinded to the group assignments. The rats were placed on an elevated steel mesh grid that could completely expose the middle of the hind paw. The animals were habituated to the testing environment for at least 30 min. The behavioral responses were noted as the paw withdrawal threshold (PWT). The filaments had the gradually increasing stiffness (2, 4, 6, 8, 10, 15, and 26 g) applied to the plantar surface for 5–6 s for each filament. Positive signs of withdrawal included pulling back rapidly, biting, shaking the hind limb, and vocalization within the 5 s being pricked by one of the von Frey filaments. The interval between trials was at least 3 min. For each trial, the ipsilateral hind paw was stimulated 10 times by a single von Frey filament before being stimulated by the next larger filament. The smallest value of filament that induced positive signs was recorded as PWT. The PWT baseline value for each animal was obtained as thermal baseline and then tested at the time of 2, 6, 12, and 24 h and 2–7 d after CFA injection.
      All measurements were performed fully randomized and blinded; the reader did not know what treatment each rat received.

      2.4 Western blot analyses

      Rats were deeply anesthetized with pentobarbital (60 mg/kg, intraperitoneally) and were rapidly sacrificed. The left L5 spinal dorsal horn was dissected on ice and was then homogenized in sodium dodecyl sulphate sample buffer with a mixture of proteinase and phosphatase inhibitors (Sigma). The crude homogenate was centrifuged at 4°C for 15 min at 1000g. The electrophoresis samples were heated at 99°C for 5 min and loaded onto 10% sodium dodecyl sulphate–polyacrylamide gels with standard Laemmli solutions (Bio-Rad Laboratories, Hercules, CA). The proteins were electroblotted onto a polyvinylidene difluoride membrane (Immobilon-P; Millipore, Billerica, MA). After being blocked in the solution containing Tris-buffered saline with 0.02 % Tween-20 and 3% nonfat milk for 1 h, the membrane was incubated overnight with primary antibodies: mouse anti-glia fibrillary acidic protein (GFAP, 1:1000; Sigma), mouse anti-OX42 (1:1000; Sigma), rabbit anti-phosphorylated extracellular signal–regulated kinase (pERK, 1:1000; Cell Signaling Technology, Boston, MA), and rabbit anti-ERK (1:1000; Sigma). The immunoblots were then reacted with the relative horseradish peroxidase–conjugated secondary antibodies (anti-rabbit 1:3000 and anti-mouse 1:5000; Amersham Pharmacia Biotech, Inc, Piscataway, NJ). All reactions were detected by the enhanced chemiluminescence detection method (Amersham Pharmacia Biotech, Inc) and exposure to film. The same size of square was drawn around each band to measure the density and the background near that band was subtracted. Target protein levels were normalized against β-actin levels and expressed as relative fold changes compared with the control group.

      2.5 Immunofluorescent histochemistry

      Rats were deeply anesthetized and then perfused with 100 mL of normal saline followed by 500 mL of 0.1 M phosphate buffer (pH 7.3) containing 4% paraformaldehyde. The L5 spinal cord was harvested and immersed in 30% sucrose overnight at 4°C; 25-μm frozen sections were then cut in a cryostat. The sections were rinsed in phosphate buffered saline (PBS; pH 7.3) three times (10 min each) and blocked for 1 h at 37°C in 0.01 M PBS containing 10% normal goat serum and 0.3% Triton X-100. The sections were incubated for 48 h at 4°C with primary antibodies: mouse anti-OX42 (1:200; Sigma) and mouse anti-GFAP (1:500; Sigma). After washed in PBS, the sections were incubated for 4 h with Alexa 488–conjugated donkey anti-mouse (1:500; Invitrogen, Eugene, OR). The images were captured on a confocal laser scanning microscope (Olympus FV1000; Olympus, Tokyo, Japan).

      2.6 Real-time polymerase chain reaction

      The rats were sacrificed by intraperitoneal injection of pentobarbital (60 mg/kg) and the L5 spinal cord was rapidly dissected on ice. The total RNA was extracted with Trizol reagent (Gibco/BRL Life Technologies, Inc, Grand Island, NY). The complementary DNA (cDNA) was synthesized with oligo (dT) 12–18 primers using Superscript III Reverse Transcriptase for reverse transcription–polymerase chain reaction (RT-PCR) (Invitrogen, Carlsbad, CA). The primers used in this study are described in Table. To prepare cDNA, equal amounts of RNA (1 μg) were amplified using SYBR Premix Ex Taq (Takara, Tokyo, Japan) and analyzed by real-time PCR (Applied Biosystems, Foster City, CA). The amplification protocol was as follows: 3 min at 95°C, followed by 45 cycles of 10 s at 95°C for denaturation and 45 s at 60°C for annealing and extension. Target cDNA quantities were estimated from the threshold amplification cycle number (Ct) using Sequence Detection System software (Applied Biosystems).
      TablePrimers.
      NameRT forward primer (5′–3′)PCR reverse primer (5′–3′)Temperature (°C)
      TNF-αTGATCGGTCCCAACAAGGATGCTTGGTGGTTTGCTACGA60
      IL-1βTGCTGATGTACCAGTTGGGGCTCCATGAGCTTTGTACAAG60
      IL-6GCCCTTCAGGAACAGCTATGCAGAATTGCCATTGCACAAC60
      GAPDHCCCCCAATGTATCCGTTGTGTAGCCCAGGATGCCCTTTAGT60
      To normalize the variation between cDNA aliquots, we calculated a ΔCt value for each sample by subtracting the Ct value of the sample from the Ct value for a corresponding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sample. We chose GAPDH as an endogenous internal standard to control for variations in RT-PCR efficiency. The quantity of cDNA for each sample was calculated as 2ΔCt.

      2.7 Statistics

      All data are presented as the mean ± standard error. Two-way analysis of variance followed by the least significant difference test was used for Western blot analysis and real-time PCR. Repeated measures analysis of variance (with Bonferroni confidence interval adjustment) was used and conducted for behavioral data, which were justified as a normal distribution by the one-sample Kolmogorov–Smirnov test (data not shown). All statistical analyses were performed using SPSS version 16.0 software (SPSS, Inc, Chicago, IL). The differences with a P value of ≤0.05 were considered significant.

      3. Results

      3.1 Triptolide attenuates the development of CFA-induced mechanical and thermal hypersensitivities

      We assessed the PWT as baseline values in response to mechanical stimuli using von Frey filaments 2 d before CFA injection and then the PWTs from 2 h to 7 d after CFA injection recorded (Fig. 1A). In our study, the data showed that the PWT significantly decreased at 2 h after CFA injection and reached a minimum at 24 h, and the mechanical hypersensitivity of the rats lasts to the last time points (7 d). The triptolide treatment could significantly alleviate the mechanical hypersensitivity compared with the CFA group. However, no effect was observed between the saline and saline + triptolide groups on mechanical hypersensitivity.
      Figure thumbnail gr1
      Fig. 1The effects of triptolide administration on mechanical (A) and thermal (B) hypersensitivities. During the days from 2 d before CFA injection to 7 d after, each time point represents as mean ± standard error of the mean of the PWT in response to mechanical stimuli and PWL in response to thermal stimuli. The rats were divided into four groups (saline, saline + triptolide, CFA, and CFA + triptolide) and each group contains six rats. *P < 0.05 indicates the significant differences between the CFA and CFA + triptolide groups. (Color version of figure is available online.)
      The thermal hypersensitivity of the rats depicted by PWL showed that there is significant decrease at 2 h after CFA injection (Fig. 1B), and the thermal stimuli induced decrease of PWL reached a valley at 24 h. Administration of triptolide significantly alleviated this effect at time points ranging from 6 h to 7 d after CFA injection. These data showed that the response threshold to thermal stimuli was enhanced by triptolide compared with the rats given only CFA. Nevertheless, there was no significant difference in PWLs between the saline + triptolide and saline groups.

      3.2 Spinal glia activation involved in the CFA-induced hypersensitivity

      Triptolide treatment (100 μg/kg) had no effect on GFAP or OX42 expression in saline groups. After CFA injection, the expression levels of GFAP and OX42 were significantly increased (Fig. 2); the OX42 was significantly higher than the control groups at day 1, whereas the GFAP was significantly higher at day 3 (Fig. 3C). After triptolide administration, GFAP and OX42 levels were remarkably decreased compared with the CFA group, although the OX42 level was still higher than that of the saline groups (Fig. 3B). The expression levels of GFAP and OX42 in Western blot analysis in the CFA-T rats were still higher than the saline groups after triptolide injection, whereas the expression levels of GFAP in CFA-T group was not statistically higher than the control groups (Fig. 3C). These results most probably mean that the microglia was more sensitive in response to the inflammatory pain than the astrocytes.
      Figure thumbnail gr2
      Fig. 2The expression of microglial marker OX42 (A–D) and astrocytic marker GFAP (E–H) are revealed by immunofluorescent histochemistry. The data showed that the triptolide (T) could inhibit CFA-induced spinal glial activation. The immunoreactivities for GFAP and OX42 within the superficial dorsal horn were significantly increased after CFA injected, and the triptolide administration could reverse these effects. The immunostaining sections in the reversal study are not shown. The scale bar = 200 μm. (Color version of figure is available online.)
      Figure thumbnail gr3
      Fig. 3Western blot analyses of the expression level of microglial marker OX42 and astrocytic marker GFAP in the spinal dorsal horn (A). No differences were observed in the two saline-treated groups. However, CFA-induced OX42 expression was significantly higher than the saline groups and GFAP (*P < 0.05). In the CFA groups, the OX42 expression was significantly inhibited after the triptolide injection (*P < 0.05), although the level was still significantly higher than the saline groups (#P < 0.05) (B). However, in the CFA groups, no significance difference of GFAP was observed after triptolide administration compared with the saline groups(C).

      3.3 The effects of triptolide on CFA-induced extracellular signal–regulated kinase activation

      The Western blot study showed that the extracellular signal–regulated kinase (ERK) and pERK have two subtypes, and the triptolide administration has no effect on the expressions of phosphorylated-ERK (pERK1/2) in the saline groups respectively. But the expression level of pERK1/2 was significantly increased in the CFA-injected rats (Fig. 4A). The expression level of pERK1/2 was significantly increased at the time point of 6 h after CFA injection and reached a peak at day 3 (0.67 ± 0.09 folds of β-actin, Fig. 4B, P < 0.05) and then lasted to 7 d (0.58 ± 0.08 folds, Fig. 4B, P < 0.05). After triptolide administration, we observed that the total ERK1/2 expression level has no significant difference between the rat groups; nevertheless, the pERK1/2 expression level was remarkably decreased compared with the CFA group at day 3 (0.34 ± 0.07 folds, P < 0.05), although the expression level was still higher than the saline groups. The change of pERK1/2 was similar to that of microglia. Remarkably, the double immunofluorescence labeling in spinal dorsal horn shows that the pERK were immunoreactive with OX42 or GFAP in CFA groups (Fig. 4D). Furthermore, a pERK inhibitor U0126 has been used for verifying the role of pERK signaling pathway involved in the study. The results showed that the U0126 could significantly alleviate either mechanical or thermal hypersensitivity induced by the CFA, showing that the effect of triptolide was much the same as the pERK inhibitor (Fig. 5).
      Figure thumbnail gr4
      Fig. 4Western blot analyses of phosphorylated-ERK (pERK1/2) expression in the spinal cord. No differences observed in the two saline-treated groups (A). However, CFA-induced pERK expression was significantly higher than the saline groups. In the CFA groups, triptolide could inhibit the pERK expression (*P < 0.05), although the level was still significantly higher than the saline groups (#P < 0.05) (B). The total ERK expression level was not significantly changed between the rat groups (C). Double immunofluorescence labeling in spinal dorsal horn shows that the pERK was immunoreactive with OX42 or GFAP in CFA groups (D). Scale bar = 10 μm. (Color version of figure is available online.)
      Figure thumbnail gr5
      Fig. 5The effects of pERK inhibitor U0126 administration on mechanical (A) and thermal (B) hypersensitivities. The protocol and the data management are the same as previously mentioned. The rats were divided into five groups (saline, saline + U0126, CFA, CFA + U0126 and CFA + triptolide) and each group contains six rats. *P < 0.05 indicates the significant differences compared with the CFA groups, #P < 0.05 indicates the significant differences between the CFA + T and CFA + U0126 groups. (Color version of figure is available online.)

      3.4 Triptolide treatment reduces the levels of the proinflammatory cytokines IL-1β, IL-6, and TNF-α

      We observed these inflammatory mediators in the spinal dorsal horn with real-time RT-PCR. The levels of the proinflammatory cytokines IL-1β, IL-6, and TNF-α were significantly increased after CFA injection. Prophylactic treatment with triptolide could significantly decrease the messenger RNA level of the IL-1β (499.1 ± 41.2% of naive, P < 0.05), IL-6 (399.3 ± 36.6%, P < 0.05), and TNF-α (230.2 ± 23.8%, P < 0.05) compared with the CFA group. In addition, no effect of the triptolide on IL-6, IL-1β, and TNF-α was observed between the saline groups (Fig. 6). These data indicated that systemic treatment with triptolide could inhibit the production of inflammatory mediators in the spinal dorsal horn.
      Figure thumbnail gr6
      Fig. 6RT-PCR analysis of mRNA levels of inflammatory mediators IL-1β, IL-6, and TNF-α (A–C). Data are normalized against GAPDH levels and expressed as a percentage of the naive group. Triptolide significantly prevents and reverses CFA-induced increases of these inflammatory mediators in the spinal dorsal horn. *P < 0.05 compared with the saline groups. #P < 0.05 compared with the CFA group at the same time points. mRNA = messenger RNA.

      4. Discussion

      Inflammatory pain is a common clinical symptom that still lacks effective treatment; the most frequently used agents such as nonsteroidal anti-inflammatory drugs and selective cyclooxygenase-2 inhibitors are associated with adverse effects, such as cardiac side effects, renal toxicity, and blood clotting problems [
      • Sun S.
      • Yin Y.
      • Yin X.
      • et al.
      Anti-nociceptive effects of Tanshinone IIA (TIIA) in a rat model of complete Freund's adjuvant (CFA)-induced inflammatory pain.
      ,
      • Tadros N.N.
      • Bland L.
      • Legg E.
      • et al.
      A single dose of a non-steroidal anti-inflammatory drug (NSAID) prevents severe pain after ureteric stent removal: a prospective, randomised, double-blind, placebo-controlled trial.
      ]. New drugs are urgently needed for more effectiveness and fewer side effects. The present study examined the effect of the Chinese herb extract triptolide on inflammation-induced pain based on a rat model established by CFA, the data showed that prophylactic and repeated treatment of triptolide injection could prevent the induction and reverse the inflammatory pain without influencing basic pain threshold, this was probably affected by regulating the phosphorylation of ERK signaling and inhibiting the glia activation and inflammatory cytokines expression in the spinal cord.
      CFA has commonly been used to produce acute inflammatory pain being injected to the hind paw in rats [
      • Hylden J.L.
      • Nahin R.L.
      • Traub R.J.
      • et al.
      Expansion of receptive fields of spinal lamina I projection neurons in rats with unilateral adjuvant-induced inflammation: the contribution of dorsal horn mechanisms.
      ,
      • Iadarola M.J.
      • Brady L.S.
      • Draisci G.
      • et al.
      Enhancement of dynorphin gene expression in spinal cord following experimental inflammation: stimulus specificity, behavioral parameters and opioid receptor binding.
      ]. In our study, we found that the hind paw of CFA-injected rats swelling for approximately 6 h after CFA injection, then followed the thermal and mechanical hypersensitivities, and the ipsilateral hypersensitivity peaked at 24 h after injection. Inflammatory cytokines may induce the edema and hypersensitivity of the injected hind paw [
      • Cunha T.M.
      • Verri Jr., W.A.
      • Silva J.S.
      • et al.
      A cascade of cytokines mediates mechanical inflammatory hypernociception in mice.
      ]. Accumulating evidence showed that the immune response (including activated glial cells and upregulated expression of cytokines) in the spinal dorsal horn plays essential roles in the pain induction [
      • Ren K.
      • Dubner R.
      Interactions between the immune and nervous systems in pain.
      ,
      • Gao Y.J.
      • Ji R.R.
      Chemokines, neuronal-glial interactions, and central processing of neuropathic pain.
      ]. The central immune activation may be a potential target for treating such acute inflammatory pain. The triptolide extract has a potent anti-inflammatory and immunosuppressive effect and has been successfully used in the treatment of inflammatory diseases [
      • Liu Q.
      Triptolide and its expanding multiple pharmacological functions.
      ]. The triptolide can penetrate the blood-brain barrier easily [
      • Zhang F.
      • Li Y.C.
      [Progress in structure modification of triptolide].
      ]. Our data suggest that triptolide may have therapeutic effect on the CFA-induced inflammatory pain through inhibiting immune response in the spinal cord. Our results were similar to the previous report [
      • Sun S.
      • Yin Y.
      • Yin X.
      • et al.
      Anti-nociceptive effects of Tanshinone IIA (TIIA) in a rat model of complete Freund's adjuvant (CFA)-induced inflammatory pain.
      ,
      • Li F.Q.
      • Lu X.Z.
      • Liang X.B.
      • et al.
      Triptolide, a Chinese herbal extract, protects dopaminergic neurons from inflammation-mediated damage through inhibition of microglial activation.
      ,
      • Zhang F.
      • Li Y.C.
      [Progress in structure modification of triptolide].
      ] and the data in our study, suggesting that the systemic treatment with triptolide has a strong anti-inflammatory effect but needs repetitive treatments.
      We then explored the potential underlying mechanisms of the antihypersensitivity effect of triptolide. It has been reported that triptolide has strong anti-inflammatory activities on microglia [
      • Zhou H.F.
      • Niu D.B.
      • Xue B.
      • et al.
      Triptolide inhibits TNF-alpha, IL-1 beta and NO production in primary microglial cultures.
      ] and astrocytes [
      • Dai Y.Q.
      • Jin D.Z.
      • Zhu X.Z.
      • et al.
      Triptolide inhibits COX-2 expression via NF-kappa B pathway in astrocytes.
      ]. Furthermore, the glia activation may be the key role in the inflammatory pain induction [
      • Miyagi M.
      • Ishikawa T.
      • Orita S.
      • et al.
      Disk injury in rats produces persistent increases in pain-related neuropeptides in dorsal root ganglia and spinal cord glia but only transient increases in inflammatory mediators: pathomechanism of chronic diskogenic low back pain.
      ], the glia activation in our study was significantly inhibited by the triptolide administration, and the microglia may play a key role in the inflammatory pain induction, but not the astrocytes, as the astrocyte activation was observed at the day 7 after CFA injection. We think that the microglia activation may be much sensitive than the astrocytes and mostly involved in the acute inflammatory pain induction. Interestingly, we observed that the inhibiting effect of triptolide on the glial cell activation in the spinal cord was in CFA groups rather than in the saline control groups, the microglia marker OX42 and astrocyte marker GFAP are significantly increased at day 7 after CFA injection in CFA group, and the increase of OX42 was much faster than the GFAP and the increase of GFAP has no significant difference comparing with the saline groups.
      Mitogen-activated protein kinases (MAPKs), which includes ERKs, p38, and c-Jun N-terminal kinases, play important roles in inflammatory pain sensitization [
      • Sun S.
      • Yin Y.
      • Yin X.
      • et al.
      Anti-nociceptive effects of Tanshinone IIA (TIIA) in a rat model of complete Freund's adjuvant (CFA)-induced inflammatory pain.
      ]. Activation of MAPKs has been implicated in a number of signaling events that are important for the induction and maintenance of pain [
      • Ji R.R.
      • RWt Gereau
      • Malcangio M.
      • et al.
      MAP kinase and pain.
      ,
      • Seino D.
      • Tokunaga A.
      • Tachibana T.
      • et al.
      The role of ERK signaling and the P2X receptor on mechanical pain evoked by movement of inflamed knee joint.
      ]. MAPKs activation initiate signaling cascades and increase the synthesis of proinflammatory mediators [
      • Ji R.R.
      • RWt Gereau
      • Malcangio M.
      • et al.
      MAP kinase and pain.
      ]. In vitro studies suggest that triptolide could suppress MAPKs phosphorylation [
      • Gong Y.
      • Xue B.
      • Jiao J.
      • et al.
      Triptolide inhibits COX-2 expression and PGE2 release by suppressing the activity of NF-kappaB and JNK in LPS-treated microglia.
      ,
      • Pan X.D.
      • Chen X.C.
      • Zhu Y.G.
      • et al.
      Tripchlorolide protects neuronal cells from microglia-mediated beta-amyloid neurotoxicity through inhibiting NF-kappaB and JNK signaling.
      ]. In this study, we investigated the activation of a member of the MAPK signaling pathway, ERK, which plays an important role in inflammatory pain. In sensory neurons, pERK was contributed to noxious stimuli [
      • Ji R.R.
      Mitogen-activated protein kinases as potential targets for pain killers.
      ,
      • Galan A.
      • Cervero F.
      • Laird J.M.
      Extracellular signaling-regulated kinase-1 and -2 (ERK 1/2) mediate referred hyperalgesia in a murine model of visceral pain.
      ], and inhibition of pERK has been shown to have anti-nociceptive effects in several pain models [
      • Svensson C.I.
      • Hua X.Y.
      • Protter A.A.
      • et al.
      Spinal p38 MAP kinase is necessary for NMDA-induced spinal PGE(2) release and thermal hyperalgesia.
      ,
      • Jin S.X.
      • Zhuang Z.Y.
      • Woolf C.J.
      • et al.
      p38 mitogen-activated protein kinase is activated after a spinal nerve ligation in spinal cord microglia and dorsal root ganglion neurons and contributes to the generation of neuropathic pain.
      ]. Although the effect of triptolide was significantly poor than the U0126 in some time points, the difference was turned to be slightly during the whole experiment procedure, the triptolide may be served as a analgesia drug by downregulating the ERK activation.
      Injection of CFA is known to be causing the release of a series of inflammatory mediators, including cytokines [
      • Sun S.
      • Yin Y.
      • Yin X.
      • et al.
      Anti-nociceptive effects of Tanshinone IIA (TIIA) in a rat model of complete Freund's adjuvant (CFA)-induced inflammatory pain.
      ]. Using the CFA model, we found that prophylactic treatment with triptolide can alleviate CFA-induced inflammation through the inhibition of the pERK signaling pathway and reduce the production and/or release of the proinflammatory cytokines such as IL1-β, IL-6, and TNF-α. Previous in vitro studies have confirmed that triptolide inhibits inflammatory mediators including cytokine IL1-β, IL-6, and TNF-α [
      • Zhou H.F.
      • Niu D.B.
      • Xue B.
      • et al.
      Triptolide inhibits TNF-alpha, IL-1 beta and NO production in primary microglial cultures.
      ,
      • Wang Y.
      • Wei D.
      • Lai Z.
      • et al.
      Triptolide inhibits CC chemokines expressed in rat adjuvant-induced arthritis.
      ]. The anti-inflammatory effect of triptolide in the study is similar to that of the inhibitors of spinal glia, in which decreased expressions of inflammatory mediators could inhibit the excitatory synaptic transmission during pain processing and thus produce anti-nociception effect. Therefore, the effects of triptolide in suppressing inflammatory symptoms may be related to the ability of altering the cytokines following inflammation.
      These results demonstrate that the triptolide could effectively attenuate the acute inflammatory pain induced by CFA, the underlying mechanisms may regulate the pERK signaling pathway and inhibit the spinal glia activation, then downregulate the proinflammatory cytokines; the triptolide may be clinically useful as a drug of anti-inflammatory pain.

      5. Conclusion

      In the present study, we first reported that the repeated systemic administration of triptolide could successfully prevent and reverse inflammatory pain without changing the normal pain behavior. The triptolide may serve as a potential compound for developing safe new therapeutics for patients suffering acute inflammatory pain.

      Acknowledgment

      The study was supported by the Beijing Promising talent project (2013107), Postdoctoral Science Foundation (2012M521875 and 2012M 521864), National Natural Science Foundation of China (81200324), Hainan Natural Science Foundation (813222), Special Financial Grant of China Postdoctoral Science Foundation (2013T60949), and Bureau of Health Medical Scientific Research Foundation of Hainan Province (Qiongwei 2012 PT-70). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
      Conflict of interest: The authors declare that they have no competing interests.

      References

        • Okuda K.
        • Takeshima N.
        • Hagiwara S.
        • et al.
        New anthranilic acid derivative, EAntS-GS, attenuates Freund's complete adjuvant-induced acute pain in rats.
        J Surg Res. 2012; 175: 265
        • Kiguchi N.
        • Maeda T.
        • Kobayashi Y.
        • et al.
        Involvement of inflammatory mediators in neuropathic pain caused by vincristine.
        Int Rev Neurobiol. 2009; 85: 179
        • Sun S.
        • Yin Y.
        • Yin X.
        • et al.
        Anti-nociceptive effects of Tanshinone IIA (TIIA) in a rat model of complete Freund's adjuvant (CFA)-induced inflammatory pain.
        Brain Res Bull. 2012; 88: 581
        • Kidd B.L.
        • Urban L.A.
        Mechanisms of inflammatory pain.
        Br J Anaesth. 2001; 87: 3
        • Ji R.R.
        • Woolf C.J.
        Neuronal plasticity and signal transduction in nociceptive neurons: implications for the initiation and maintenance of pathological pain.
        Neurobiol Dis. 2001; 8: 1
        • Iwatsuki K.
        • Arai T.
        • Ota H.
        • et al.
        Targeting anti-inflammatory treatment can ameliorate injury-induced neuropathic pain.
        PLoS One. 2013; 8: e57721
        • Verri Jr., W.A.
        • Cunha T.M.
        • Parada C.A.
        • et al.
        Hypernociceptive role of cytokines and chemokines: targets for analgesic drug development?.
        Pharmacol Ther. 2006; 112: 116
        • Okamoto T.
        • Iwata S.
        • Ohnuma K.
        • et al.
        Histamine H1-receptor antagonists with immunomodulating activities: potential use for modulating T helper type 1 (Th1)/Th2 cytokine imbalance and inflammatory responses in allergic diseases.
        Clin Exp Immunol. 2009; 157: 27
        • Standiford T.J.
        Anti-inflammatory cytokines and cytokine antagonists.
        Curr Pharm Des. 2000; 6: 633
        • Mendell J.R.
        • Sahenk Z.
        Clinical practice. Painful sensory neuropathy.
        N Engl J Med. 2003; 348: 1243
        • Minami M.
        • Katayama T.
        • Satoh M.
        Brain cytokines and chemokines: roles in ischemic injury and pain.
        J Pharmacol Sci. 2006; 100: 461
        • Calixto J.B.
        • Otuki M.F.
        • Santos A.R.
        Anti-inflammatory compounds of plant origin. Part I. Action on arachidonic acid pathway, nitric oxide and nuclear factor kappa B (NF-kappaB).
        Planta Med. 2003; 69: 973
        • Calixto J.B.
        • Campos M.M.
        • Otuki M.F.
        • et al.
        Anti-inflammatory compounds of plant origin. Part II. Modulation of pro-inflammatory cytokines, chemokines and adhesion molecules.
        Planta Med. 2004; 70: 93
        • Qiu D.
        • Kao P.N.
        Immunosuppressive and anti-inflammatory mechanisms of triptolide, the principal active diterpenoid from the Chinese medicinal herb Tripterygium wilfordii Hook. f.
        Drugs R D. 2003; 4: 1
        • Li F.Q.
        • Lu X.Z.
        • Liang X.B.
        • et al.
        Triptolide, a Chinese herbal extract, protects dopaminergic neurons from inflammation-mediated damage through inhibition of microglial activation.
        J Neuroimmunol. 2004; 148: 24
        • Zimmermann M.
        Ethical guidelines for investigations of experimental pain in conscious animals.
        Pain. 1983; 16: 109
        • Chang M.
        • Smith S.
        • Thorpe A.
        • et al.
        Evaluation of phenoxybenzamine in the CFA model of pain following gene expression studies and connectivity mapping.
        Mol Pain. 2010; 6: 56
        • Wang W.
        • Mei X.P.
        • Chen L.
        • et al.
        Triptolide prevents and attenuates neuropathic pain via inhibiting central immune response.
        Pain Physician. 2012; 15: E995
        • Wang W.
        • Wang W.
        • Mei X.
        • et al.
        Crosstalk between spinal astrocytes and neurons in nerve injury-induced neuropathic pain.
        PLoS One. 2009; 4: e6973
        • Wang W.
        • Mei X.P.
        • Wei Y.Y.
        • et al.
        Neuronal NR2B-containing NMDA receptor mediates spinal astrocytic c-Jun N-terminal kinase activation in a rat model of neuropathic pain.
        Brain Behav Immun. 2011; 25: 1355
        • Tadros N.N.
        • Bland L.
        • Legg E.
        • et al.
        A single dose of a non-steroidal anti-inflammatory drug (NSAID) prevents severe pain after ureteric stent removal: a prospective, randomised, double-blind, placebo-controlled trial.
        BJU Int. 2013; 111: 101
        • Hylden J.L.
        • Nahin R.L.
        • Traub R.J.
        • et al.
        Expansion of receptive fields of spinal lamina I projection neurons in rats with unilateral adjuvant-induced inflammation: the contribution of dorsal horn mechanisms.
        Pain. 1989; 37: 229
        • Iadarola M.J.
        • Brady L.S.
        • Draisci G.
        • et al.
        Enhancement of dynorphin gene expression in spinal cord following experimental inflammation: stimulus specificity, behavioral parameters and opioid receptor binding.
        Pain. 1988; 35: 313
        • Cunha T.M.
        • Verri Jr., W.A.
        • Silva J.S.
        • et al.
        A cascade of cytokines mediates mechanical inflammatory hypernociception in mice.
        Proc Natl Acad Sci U S A. 2005; 102: 1755
        • Ren K.
        • Dubner R.
        Interactions between the immune and nervous systems in pain.
        Nat Med. 2010; 16: 1267
        • Gao Y.J.
        • Ji R.R.
        Chemokines, neuronal-glial interactions, and central processing of neuropathic pain.
        Pharmacol Ther. 2010; 126: 56
        • Liu Q.
        Triptolide and its expanding multiple pharmacological functions.
        Int Immunopharmacol. 2011; 11: 377
        • Zhang F.
        • Li Y.C.
        [Progress in structure modification of triptolide].
        Yao Xue Xue Bao. 2004; 39: 857
        • Zhou H.F.
        • Niu D.B.
        • Xue B.
        • et al.
        Triptolide inhibits TNF-alpha, IL-1 beta and NO production in primary microglial cultures.
        Neuroreport. 2003; 14: 1091
        • Dai Y.Q.
        • Jin D.Z.
        • Zhu X.Z.
        • et al.
        Triptolide inhibits COX-2 expression via NF-kappa B pathway in astrocytes.
        Neurosci Res. 2006; 55: 154
        • Miyagi M.
        • Ishikawa T.
        • Orita S.
        • et al.
        Disk injury in rats produces persistent increases in pain-related neuropeptides in dorsal root ganglia and spinal cord glia but only transient increases in inflammatory mediators: pathomechanism of chronic diskogenic low back pain.
        Spine (Phila Pa 1976). 2011; 36: 2260
        • Ji R.R.
        • RWt Gereau
        • Malcangio M.
        • et al.
        MAP kinase and pain.
        Brain Res Rev. 2009; 60: 135
        • Seino D.
        • Tokunaga A.
        • Tachibana T.
        • et al.
        The role of ERK signaling and the P2X receptor on mechanical pain evoked by movement of inflamed knee joint.
        Pain. 2006; 123: 193
        • Gong Y.
        • Xue B.
        • Jiao J.
        • et al.
        Triptolide inhibits COX-2 expression and PGE2 release by suppressing the activity of NF-kappaB and JNK in LPS-treated microglia.
        J Neurochem. 2008; 107: 779
        • Pan X.D.
        • Chen X.C.
        • Zhu Y.G.
        • et al.
        Tripchlorolide protects neuronal cells from microglia-mediated beta-amyloid neurotoxicity through inhibiting NF-kappaB and JNK signaling.
        Glia. 2009; 57: 1227
        • Ji R.R.
        Mitogen-activated protein kinases as potential targets for pain killers.
        Curr Opin Investig Drugs. 2004; 5: 71
        • Galan A.
        • Cervero F.
        • Laird J.M.
        Extracellular signaling-regulated kinase-1 and -2 (ERK 1/2) mediate referred hyperalgesia in a murine model of visceral pain.
        Brain Res Mol Brain Res. 2003; 116: 126
        • Svensson C.I.
        • Hua X.Y.
        • Protter A.A.
        • et al.
        Spinal p38 MAP kinase is necessary for NMDA-induced spinal PGE(2) release and thermal hyperalgesia.
        Neuroreport. 2003; 14: 1153
        • Jin S.X.
        • Zhuang Z.Y.
        • Woolf C.J.
        • et al.
        p38 mitogen-activated protein kinase is activated after a spinal nerve ligation in spinal cord microglia and dorsal root ganglion neurons and contributes to the generation of neuropathic pain.
        J Neurosci. 2003; 23: 4017
        • Wang Y.
        • Wei D.
        • Lai Z.
        • et al.
        Triptolide inhibits CC chemokines expressed in rat adjuvant-induced arthritis.
        Int Immunopharmacol. 2006; 6: 1825