Advertisement

Resolvin D1 attenuates lipopolysaccharide induced acute lung injury through CXCL-12/CXCR4 pathway

  • Author Footnotes
    1 These authors joint first authors and contributed equally to this work.
    Wang Yaxin
    Footnotes
    1 These authors joint first authors and contributed equally to this work.
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Author Footnotes
    1 These authors joint first authors and contributed equally to this work.
    Yao Shanglong
    Footnotes
    1 These authors joint first authors and contributed equally to this work.
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Shu Huaqing
    Correspondence
    Corresponding author. Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430030, China. Tel.: +86-13437284416.
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Liu Hong
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Yuan Shiying
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Chen Xiangdong
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Li Ruidong
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Wu Xiaoying
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Guo Lina
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Wang Yan
    Affiliations
    Department of Anesthesiology and Critical Care, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for articles by this author
  • Author Footnotes
    1 These authors joint first authors and contributed equally to this work.
Published:December 09, 2013DOI:https://doi.org/10.1016/j.jss.2013.11.1107

      Abstract

      Background

      The recruitment of neutrophils plays an important role in the progress of acute lung injury (ALI). Excessive neutrophils released from bone marrow accumulate in lung, release proinflammatory factors, and cause tissue damage. CXCL-12/CXCR4 is an important signaling pathway, which regulates the migration of bone marrow hematopoietic cells out of bone marrow and involves in neutrophil accumulation and retention in the inflammatory site. Resolvin D1 (RvD1) is a kind of lipid mediators, which can alleviate many inflammatory diseases. We hypothesized that RvD1 can alleviate lipopolysaccharide (LPS)-induced ALI through regulating CXCL-12/CXCR4 pathway.

      Methods

      We randomized mice into five groups: control group, RvD1 group, LPS group, LPS plus RvD1 group, and LPS plus AMD3100 group. ALI was established by intratracheal instillation of LPS. After 24 and 72 h, mice were sacrificed, and lung tissues were harvested for histologic analysis, wet-to-dry ratio, myeloperoxidase activity, and CXCL-12 expression. Bronchoalveolar fluid was collected for protein analysis, cytokines assay, and flow cytometry analysis.

      Results

      Histologic findings as well as wet-to-dry ratio, protein concentration, cytokines assay, neutrophil number, and myeloperoxidase activity confirmed that RvD1 and AMD3100 alleviated LPS-induced ALI. RvD1 decreased CXCL-12 messenger RNA expression in lung. However, RvD1 promoted CXCR4 expression in neutrophils in the initial stage of inflammation and reduced its level in the later stage.

      Conclusions

      RvD1 protects LPS-induced ALI partially through regulating CXCL-12/CXCR4 pathway.

      Keywords

      1. Introduction

      Acute lung injury (ALI) is a cause of acute respiratory failure, which is characterized by diffusive injury of alveolar-capillary barrier, resulting in influx of protein-rich edema fluid. Excessive inflammation is a component of many causes of direct injury to the alveolar-capillary membranes [
      • Matthay M.A.
      • Zimmerman G.A.
      Acute lung injury and the acute respiratory distress syndrome: four decades of inquiry into pathogenesis and rational management.
      ]. Along with the development of inflammation, a swift of innate immune response is induced. This response involves the production of cytokines and chemokines and the vigorous recruitment of immune cells from the bone marrow into the infected tissue.
      Activation of circulating neutrophils and transmigration into the alveolar airspace are associated with the development of ALI [
      • Reutershan J.
      • Ley K.
      Bench-to-bedside review: acute respiratory distress syndrome - how neutrophils migrate into the lung.
      ]. On recruitment to sites of infection and inflammation, they release proteolytic enzymes and reactive oxygen species targeting/killing invading pathogens [
      • Sun B.
      • Sun H.
      • Liu C.
      • Shen J.
      • Chen Z.
      • Chen X.
      Role of CO-releasing molecules liberated CO in attenuating leukocytes sequestration and inflammatory responses in the lung of thermally injured mice.
      ]. Neutrophil elimination is essential for successful host eradication of bacterial pathogens and survival in ALI. Along with inflammation subsides, neutrophils undergo apoptosis and are swallowed by macrophage. However, the migration and elimination of neutrophils are uncontrolled in ALI. Many inflammatory factors that can promote neutrophil movement have been reported, but the specific reasons are still unknown.
      One potential chemokine pathway modulating persistent neutrophilia in ALI is the CXCL-12/CXCR4 axis. CXCR4 is expressed by mature neutrophils as well as immature hematopoietic stem and progenitor cells, whereas stromal cell derived factor 1 (CXCL-12 or SDF-1) is constitutively expressed in the bone marrow by various stromal cells. CXCL-12/CXCR4 is an important factor of chemotactic response and maintaining hematopoietic cells in the bone marrow [
      • Borregaard N.
      Neutrophils, from marrow to microbes.
      ]. Modulation of chemokine-receptor axis during inflammation leads to a change in cell surface CXCR4 or CXCL-12 expression in local area, an event that triggers the migration of neutrophils. Emerging evidences have revealed that lung tissue expressed more CXCL-12 in ALI [
      • Petty J.M.
      • Sueblinvong V.
      • Lenox C.C.
      • et al.
      Pulmonary stromal-derived factor-1 expression and effect on neutrophil recruitment during acute lung injury.
      ], and the levels of CXCR4 on neutrophils increased after extravasation into injured lungs [
      • Yamada M.
      • Kubo H.
      • Kobayashi S.
      • et al.
      The increase in surface CXCR4 expression on lung extravascular neutrophils and its effects on neutrophils during endotoxin-induced lung injury.
      ]. These findings indicated CXCL-12/CXCR4 signal participated in neutrophils accumulation in lung tissue in ALI. AMD3100 is a bicyclam derivative and selectively antagonizes the CXCR4 by inhibiting the intracellular calcium influx responded to CXCL-12, which can attenuate inflammatory lung diseases, such as allergic lung inflammation [
      • Lukacs N.W.
      • Berlin A.
      • Schols D.
      • Skerlj R.T.
      • Bridger G.J.
      AMD3100, a CXCR4 antagonist, attenuates allergic lung inflammation and airway hyperreactivity.
      ] and bleomycin-induced pulmonary fibrosis [
      • Song J.S.
      • Kang C.M.
      • Kang H.H.
      • et al.
      Inhibitory effect of CXC chemokine receptor 4 antagonist AMD3100 on bleomycin induced murine pulmonary fibrosis.
      ].
      Resolvin D1 (RvD1, 7S, 8R, 17S-trihydroxy-4Z, 9E, 11E, 13-Z, 15E, 19Z-docosahexaenoic acid) is a kind of specialized pro-resolving mediators derived from polyunsaturated fatty acids, which is initially discovered in resolving exudates of mice [
      • Levy B.D.
      Resolvins and protectins: natural pharmacophores for resolution biology.
      ]. Two specific receptors of RvD1 have been found: the lipoxin A(4)/Annexin-A1 receptor formyl peptide receptor 2 [
      • Norling L.V.
      • Dalli J.
      • Flower R.J.
      • Serhan C.N.
      • Perretti M.
      Resolvin D1 limits polymorphonuclear leukocyte recruitment to inflammatory loci: receptor-dependent actions.
      ] and the orphan receptor G-protein-coupled receptor 32 [
      • Chiang N.
      • Fredman G.
      • Bäckhed F.
      • et al.
      Infection regulates pro-resolving mediators that lower antibiotic requirements.
      ]. The effects of RvD1 on inflammation are mostly involved in the two receptors. RvD1 can limit neutrophil infiltration at nanogram levels in murine peritonitis and block transendothelial migration of human polymorphonuclear leukocytes [
      • Serhan C.N.
      • Hong S.
      • Gronert K.
      • et al.
      Resolvins: a family of bioactive products of omega-3 fatty acid transformation circuits initiated by aspirin treatment that counter proinflammation signals.
      ,
      • Sun Y.P.
      • Oh S.F.
      • Uddin J.
      • et al.
      Resolvin D1 and its aspirin-triggered 17R epimer. Stereochemical assignments, anti-inflammatory properties, and enzymatic inactivation.
      ,
      • Eickmeier O.
      • Seki H.
      • Haworth O.
      • et al.
      Aspirin-triggered resolvin D1 reduces mucosal inflammation and promotes resolution in a murine model of acute lung injury.
      ,
      • Bannenberg G.L.
      • Chiang N.
      • Ariel A.
      • et al.
      Molecular circuits of resolution: formation and actions of resolvins and protectins.
      ], and bind human phagocytes enhancing acute inflammation resolving [
      • Krishnamoorthy S.
      • Recchiuti A.
      • Chiang N.
      • et al.
      Resolvin D1 binds human phagocytes with evidence for proresolving receptors.
      ]. It has been proved that RvD1 attenuates inflammation through a process involving the PPARgamma/NF-kappaB pathway in lipopolysaccharide (LPS)-induced ALI in mice [
      • Liao Z.
      • Dong J.
      • Wu W.
      • et al.
      Resolvin D1 attenuates inflammation in lipopolysaccharide-induced acute lung injury through a process involving the PPARγ/NF-κB pathway.
      ] and promotes the survival rate [
      • Wang B.
      • Gong X.
      • Wan J.Y.
      • et al.
      Resolvin D1 protects mice from LPS-induced acute lung injury.
      ]. Moreover, RvD1 reduced leukocyte numbers in bronchoalveolar lavage fluid (BALF) of LPS-treated mice [
      • Wang B.
      • Gong X.
      • Wan J.Y.
      • et al.
      Resolvin D1 protects mice from LPS-induced acute lung injury.
      ].
      We hypothesize that RvD1 regulates BALF neutrophils accumulation through CXCL-12/CXCR4 pathway. Our study aimed to elucidate the mechanism that RvD1 attenuates LPS-induced ALI and how RvD1 reduces neutrophil number in BALF. Our findings may provide a new function of RvD1 and a new direction in ALI research.

      2. Materials and methods

      2.1 Animal preparation

      BalB/c mice were purchased from Wuhan University (Wuhan, China). All mice were male, 20–25 g and housed in specific pathogen-free conditions for 5 d before experimental use. All animal experiments were permitted by the animal care and use committee of Tongji Medical College of Huazhong University of Science and Technology.

      2.2 Animal protocol

      Mice were randomly divided into five groups (n = 6/group): control group, RvD1 group, LPS group, LPS plus RvD1 group (LPS/RvD1), and LPS plus AMD3100 group (LPS/AMD3100).
      Sterile saline (0.1 mL) was administered in tail vein in control group and LPS group mice. RvD1 (dissolved in 0.1 mL saline, 3 μg/kg; Cayman Chemical, MI) was injected to mice in RvD1 group and LPS/RvD1 group and mice in LPS/AMD3100 group were received AMD3100 (dissolved in 0.1 mL saline, 5 mg/kg; Sigma-Aldrich, St. Louis, MO). After 30 min, mice were anesthetized by ketamine hydrochloride and received an intratracheal injection of LPS (2 mg/mL dissolved in saline, 3 μg/g; Escherichia coli 055:B5, Sigma-Aldrich) according to body weight. Mice in control group and RvD1 group inhaled saline (1.5 μL/g). Animals that received saline pretreatment and challenge were referred to as the control group.
      After 24or 72 h, mice were sacrificed, and lung tissues were harvested for further analysis.

      2.3 BALF

      After the animals were killed, we made a median sternotomy to expose the trachea and lung. After ligating the hilum of the left lung, a plastic catheter was inserted in the trachea. The right lung was lavaged three times with 0.5 mL phosphate-buffered saline (PBS). Total fluid was centrifuged at 1500 rpm for 10 min at 4°C. Supernatant fluid was measured by bicinchoninic acid protein assay according to the manufacturer's instruction (Beyotime Institute of Biotechnology, Shanghai, China). Cytokines assay was measured by enzyme-linked immunosorbent assay kits (Neobioscience, Shenzhen, China). The pellet was analyzed by a flow cytometer (Becton, Dickinson and Company, FACSort).

      2.4 Histology and lung injury score

      Lung samples were fixed in 4% paraformaldehyde and embedded in paraffin. Lungs were cut into sections and stained with hematoxylin and eosin for light microscopy. Lung injury pathologic changes were measured by a histologist who was blinded to experimental groups. Lung injury score was calculated by using a recently published criterion (Table), with an overall score of between 0 and 1 [
      • Matute-Bello G.
      • Downey G.
      • Moore B.B.
      • et al.
      An official American Thoracic Society workshop report: features and measurements of experimental acute lung injury in animals.
      ]. The final injury score was calculated by the following formula: score = (20 × A + 14 × B + 7 × C + 7 × D + 2 × E)/(Number of fields × 100).
      TableLung injury score system.
      ParameterScore per field
      012
      A. Neutrophils in the alveolar spaceNone1–5>5
      B. Neutrophils in the interstitial spaceNone1–5>5
      C. Hyaline membranesNone1>1
      D. Proteinaceous debris filling the airspacesNone1>1
      E. Alveolar septal thickening<2 ×2 × −4 ×>4 ×
      Score = ([20 × A] + [14 × B] + [7 × C] + [7 × D] + [2 × E])/(number of fields × 100).

      2.5 Lung wet-to-dry weight ratio

      To evaluate lung edema, inferior lobe lungs were harvested and weighted and then put in oven for 24 hat 70°C, until weight was no longer changed. The dry lungs were weighted and the wet-to-dry (W/D) ratio was calculated.

      2.6 Measurement of myeloperoxidase activity in lung tissue

      Frozen lung tissues were thawed and homogenized in normal saline. The enzyme activity was determined spectrophotometrically using a myeloperoxidase (MPO) detection kit according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). MPO activity was assessed according to the absorbance measured at 460 nm and normalized by the total protein concentration of the same sample.

      2.7 Quantitative RT-PCR for lung tissue CXCL-12

      Mouse lung tissues were pulverized on ice. RNA was extracted using trizol (TaKaRa biotechnology, Dalian, China), and 500 ng of total RNA was used to synthesize complementary DNA using SuperScript II reverse transcriptase mix according to the manufacture's instructions (TaKaRa biotechnology). Real-time polymerase chain reaction was performed using the TaqMan universal PCR master mix and system. The primer of CXCL-12 were: 5′ - GCTCTGCATCAGTGACGGTA -3′ (forward), 5′- ATTTCGGGTCAATGCACACT - 3′ (reverse) and the primer of CXCR4 were: 5′-TCAGTGGCTGACCTCCTCTT- 3′ (forward) and 5′- TTTCAGCCAGCAGTTTCCTT- 3′ (reverse). The messenger RNA (mRNA) expression of target genes was analyzed by the cycle threshold (△△Ct) method and normalized against β-actin control.

      2.8 Determination of CXCR4 expression on neutrophil surface in BALF

      Murine BALF cells (106), isolated from LPS-treated lungs, were resuspended in PBS and incubated with anti-CD16/CD32 monoclonal antibodies (eBioscience, San Diego, CA) for 10 min on ice. The cells were then incubated with anti-Gr-1-FITC monoclonal antibody (eBioscience), anti-CXCR4-PE (eBioscience) or isotype control mAbs (eBioscience) at room temperature for 50 min. After washing the cells three times using PBS, cells were collected by FACScan flow cytometer (FACSort; BD bioscience, Franklin Lakes, New Jersey, America) and data were analyzed by software (CELLQuest, BD (Becton, Dickinson and Company), Franklin Lakes, New Jersey, America). Neutrophils were distinguished by side scatter light, forward scatter light and gated by Gr-1 positive signal. Gr-1 high cells were analyzed for CXCR4 expression. Results in LPS/RvD1 group and LPS/AMD3100 group were expressed as a ratio of the mean fluorescence intensity of cells stained with CXCR4 antibody versus that of LPS group. Three to five separate experiments were performed for each analyzed population of neutrophils.

      2.9 Statistical analysis

      Data were presented as mean ± standard deviation. All data were tested by normality test. Data were analyzed using one-way variance analysis with bonferroni post hoc test for multiple t-tests. P < 0.05 was considered statistically significant.

      3. Results

      3.1 Histology and lung injury score

      Histologic examination of lung tissue after LPS inhalation indicated inflammatory change, such as alveolar wall thickening, proteinaceous debris filling the airspaces, and leukocyte infiltration into the lung interstitium (Fig. 1C). This change got worse as time prolonged (Fig. 1I). The injection of RvD1 and AMD3100 diminished histologic signs of LPS-induced inflammation (Fig. 1D, E, J, and K) at 24 and 72 h, and treatment of RvD1 did not cause the change of pulmonary histology in normal lungs (Fig. 1B and H).
      Figure thumbnail gr1
      Fig. 1Changes of lung tissue histology and lung injury score after saline or LPS inhalation in 24 h and 72 h (hematoxylin and eosin stain, scale bar: 100 μm, n = 6). (A–E) Histopathologic changes in lung tissues at 24 h. There was no histologic change in control group mouse. (A) and RvD1 group mouse. (B) LPS inhalation caused pulmonary inflammation, including infiltration of leukocytes to interstitial, proteinaceous debris filling the airspaces, and thickening of alveolar wall. (C) RvD1. (D) and AMD3100. (E) treatment could attenuate the pathologic changes induced by LPS. (F) Lung injury score in 24 h. (G–K) Histopathologic changes in lung tissues in 72 h. No morphologic change was observed in control group (G) and RvD1 group (H) mouse. LPS group mouse displayed a distinct inflammatory response in 72 h (I). Pulmonary inflammation was remitted after RvD1 (J) and AMD3100 (K) treatment. (L) Lung injury score in 72 h. All data are expressed as mean ± standard deviation. *, **, #, ##P < 0.05 compared with the LPS group. (Color version of figure is available online.)
      Lung injury scores were in accordance with the pathohistologic changes at different time points.

      3.2 Lung permeability

      The W/D ratio and bronchoalveolar protein concentration, two common indicators of lung permeability, increased after LPS instillation. Both LPS/RvD1 group and LPS/AMD3100 group impaired the W/D ratio and bronchoalveolar protein concentration at 24 and 72 h as shown in Figure 2. However, the effect of RvD1 on reducing bronchoalveolar protein concentration was more significant compared with AMD3100 (Fig. 2B and D). There was no significant difference between RvD1 group and control group in W/D ratio and bronchoalveolar protein concentration.
      Figure thumbnail gr2
      Fig. 2Lung tissue W/D ratio and total protein in bronchoalveolar fluid (n = 6). (A) The W/D ratio of lung tissue at 24 h. (B) Protein concentration in BALF at 24 h. (C) The W/D ratio of lung tissue at 72 h. (D) Protein concentration in BALF at 72 h Data are expressed as mean ± standard deviation. *, **, #, ##P < 0.05 compared with the LPS group; &P < 0.01 compared with the LPS/AMD3100 group.

      3.3 Interleukin-1 beta and tumor necrosis factor alpha levels in BALF

      ALI is almost invariably associated with elevations in proinflammatory mediators, such as interleukin-1 beta (IL-1β) and tumor necrosis factor alpha (TNF-α). As shown in Figure 3, the levels of IL-1β and TNF-α were elevated after LPS challenged at 24 and 72 h. The levels of IL-1β and TNF-α were significantly lower in LPS/RvD1 group than LPS group. AMD3100 also performed a suppression of IL-1β and TNF-α release in BALF. Furthermore, RvD1 alone could not affect the production of IL-1β and TNF-α in normal lungs.
      Figure thumbnail gr3
      Fig. 3The levels of IL-1β and TNF-α in bronchoalveolar fluid (n = 5). (A) The concentration of IL-1β in BALF at 24 h. (B) The concentration of TNF-α in BALF at 24 h. (C) IL-1β level in BALF at 72 h. (D) TNF-α level in BALF at 72 h. Data are expressed as mean ± standard deviation. *, **, #, ##P < 0.05 compared with the LPS group.

      3.4 Neutrophil count in BALF and MPO activity

      Neutrophil influx to lung tissue and alveolar is associated with ALI. To compare the change of pulmonary inflammation after RvD1 treatment, we calculated neutrophil number in BALF and measured MPO activity in lung tissue at 24 and 72 h. Figure 4A and C showed that the number of neutrophils was significantly increased in LPS group compared with control group at 24 and 72 h. Intravenous injection of RvD1 and AMD3100 suppressed LPS-induced increasing in neutrophil number, and the effect of RvD1 on inhibiting neutrophil infiltration was better than AMD3100. There was no difference between RvD1 group and control group.
      Figure thumbnail gr4
      Fig. 4Neutrophil numbers in bronchoalveolar fluid and MPO activity in lung tissue (n = 6). (A) The number of neutrophils in BALF at 24 h. (B) MPO activity in lung tissues at 24 h. (C) The number of neutrophils in BALF at 72 h. (D) MPO activity in lung tissues at 72 h. Data are expressed as mean ± standard deviation. *, **, #, ##P < 0.05 compared with the LPS group. &P < 0.05 compared with the LPS/AMD3100 group.
      We measured MPO activity as an indicator of neutrophilic infiltration. Compared with control group, the activities of MPO increased markedly in LPS group (Fig. 4B and D). Pretreatment of RvD1 and AMD3100 significantly reduced MPO activities in LPS-challenged lungs. There was no significant difference between LPS/RvD1 group and LPS/AMD3100 group in MPO activity. The MPO activity in normal lungs was not changed after RvD1 injection.

      3.5 Lung tissue CXCL-12 mRNA expression

      To determine the effect of RvD1 on CXCL-12 in LPS-induced ALI, we quantified the CXCL-12 mRNA in lung tissue. Figure 5A and B show that LPS inhalation caused a significant increase in CXCL-12 mRNA in lung tissue at 24 and 72 h, compared with control group. Both RvD1 and AMD3100 reduced CXCL-12 mRNA level as inflammation developed. However, there was no significant difference in mRNA expression between LPS/RvD1 group and LPS/AMD3100 group. RvD1 did not impact CXCL-12 expression in saline challenged lungs.
      Figure thumbnail gr5
      Fig. 5CXCL-12 mRNA expression in lung tissue (n = 6). (A) Pulmonary CXCL-12 mRNA level at 24 h. (B) Pulmonary CXCL-12 mRNA level at 72 h. Data are expressed as mean ± standard deviation. *, **, #, ##P < 0.05 compared with the LPS group.

      3.6 Neutrophil surface CXCR4 expression

      As shown in Figure 6C, the number of neutrophils, which expressed CXCR4 increased in LPS/RvD1 group, compared with LPS treatment alone (Fig. 6B) at 24 h. At the same time, the relative mean fluorescent intensity of CXCR4 positive neutrophils in LPS/RvD1 group was higher than LPS group (Fig. 6E and F). To investigate whether CXCR4 expression was changed with time prolonged, we examined the surface CXCR4 expression at 72 h (Fig. 6G–L). Pretreatment of RvD1 abolished the increase in the number of neutrophils expressing CXCR4 and the relative mean fluorescent intensity of CXCR4 positive cells (Fig. 6I, K, and L). AMD3100 treatment decreased CXCR4 level on neutrophils at 24 and 72 h after LPS instillation (Fig. 6D, E,J, and K).
      Figure thumbnail gr6
      Fig. 6CXCR4 expression on neutrophils from bronchoalveolar fluid at 24 and 72 h (n = 6). (A–F) CXCR4 expression on neutrophils from BALF at 24 h. (A) Neutrophils were stained with CXCR4 isotype control monoclonal antibodies. (B) The proportion of CXCR4 positive neutrophils in LPS group. (C) The proportion of CXCR4 positive neutrophils in LPS/RvD1 group. (D) The proportion of CXCR4 positive neutrophils in LPS/AMD3100 group. (E) Histogram of CXCR4 expression on neutrophils. Isotype control, orange line; LPS/AMD3100 group, green line; LPS group, red line; LPS/RvD1 group, blue line. (F) RMFI of neutrophils in BALF in. (G–L) CXCR4 expression on neutrophils from BALF at 72 h (G) Neutrophils were stained with CXCR4 isotype control monoclonal antibodies. (H) The proportion of CXCR4 positive neutrophils in LPS group. (I) The proportion of CXCR4 positive neutrophils in LPS/RvD1 group. (J) The proportion of CXCR4 positive neutrophils in LPS/AMD3100 group. (K) Histogram of CXCR4 expression on neutrophils. Isotype control, orange line; LPS/RvD1 group, green line; LPS/AMD3100 group, red line; LPS group: blue line. (L) RMFI of neutrophils in BALF. Data are expressed as mean ± standard deviation. #P < 0.05 compared with the LPS/AMD3100 group. *, **P < 0.05 compared with the LPS group. RMFI = relative mean fluorescence intensity. (Color version of figure is available online.)

      4. Discussion

      Our study demonstrated that LPS inhalation caused lung inflammation, increasing neutrophil infiltration and lung injury score. These phenomena are consistent with alterations known to occur in ALI. RvD1 inhibited neutrophil accumulation in alveolar space through CXCL-12/CXCR4 pathway and contributed to attenuate ALI.
      The excessive activation and migration of circulating neutrophils from blood to the alveolar airspace is one of the key events in the early development of ALI [
      • Reutershan J.
      • Ley K.
      Bench-to-bedside review: acute respiratory distress syndrome - how neutrophils migrate into the lung.
      ]. After LPS inhalation, a rapid, early influx of mature circulating neutrophils to the injured lung is followed by a slower, sustained recruitment of neutrophils from the bone marrow [
      • Petty J.M.
      • Sueblinvong V.
      • Lenox C.C.
      • et al.
      Pulmonary stromal-derived factor-1 expression and effect on neutrophil recruitment during acute lung injury.
      ]. Neutrophil infiltration in lung tissue has two climaxes. The first climax from 1 to 24 h is characterized by a massive neutrophil influx, a small increase in lymphocytes, and a decrease in macrophage numbers [
      • Ferretti S.
      • Bonneau O.
      • Dubois G.R.
      • Jones C.E.
      • Trifilieff A.
      IL-17, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophilia: IL-15 as a possible trigger.
      ]. Except the first one, there is a small climax at 72 h. Meanwhile, lymphocyte number reaches the highest level [
      • Ferretti S.
      • Bonneau O.
      • Dubois G.R.
      • Jones C.E.
      • Trifilieff A.
      IL-17, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophilia: IL-15 as a possible trigger.
      ,
      • Harris J.F.
      • Aden J.
      • Lyons C.R.
      • Tesfaigzi Y.
      Resolution of LPS-induced airway inflammation and goblet cell hyperplasia is independent of IL-18.
      ]. To investigate whether RvD1 could reduce neutrophil accumulation in BALF through CXCL-12/CXCR4 signal pathway, we designed our experiment mainly at these two different time points: 24 and 72 h.
      We first accessed the CXCL-12 mRNA expression in lung tissue. The result showed that both RvD1 and AMD3100 can decrease CXCL-12 mRNA expression during ALI development. CXCL-12 served as a neutrophil chemoattractant and played an important role in the airspace recruitment of neutrophils from blood [
      • Petty J.M.
      • Sueblinvong V.
      • Lenox C.C.
      • et al.
      Pulmonary stromal-derived factor-1 expression and effect on neutrophil recruitment during acute lung injury.
      ]. Therefore, the results revealed that RvD1 can dampen neutrophil chamotaxis and reduce neutrophil migration to alveolar space. Furthermore, CXCL-12 protects neutrophils from apoptosis contributing to neutrophil accumulation and retention in the lung [
      • Yamada M.
      • Kubo H.
      • Kobayashi S.
      • et al.
      The increase in surface CXCR4 expression on lung extravascular neutrophils and its effects on neutrophils during endotoxin-induced lung injury.
      ], meanwhile, it can suppress formyl-L-methionyl-L-leucyl-L-phenylalanine (f-Met-Leu-Phe)-induced respiratory burst and bacterial killing capacity [
      • Lukacs N.W.
      • Berlin A.
      • Schols D.
      • Skerlj R.T.
      • Bridger G.J.
      AMD3100, a CXCR4 antagonist, attenuates allergic lung inflammation and airway hyperreactivity.
      ]. For these reasons, we speculated that both RvD1 and AMD3100 can induce neutrophil apoptosis in BALF and enhance its bacterial killing capacity through reducing CXCL-12 expression in injured lungs.
      We next examined the CXCR4 level on neutrophil isolated from BALF. We observed that RvD1 increased the expression of CXCR4 on neutrophil at 24 h, but the case reversed at 72 h. Blocking CXCL-12/CXCR4 pathway by AMD3100 impaired CXCR4 expression on neutrophil at the two time points. CXCR4 play a vital role in the homing of aged neutrophils back to the bone marrow for clearance [
      • Allen C.D.
      • Ansel K.M.
      • Low C.
      • et al.
      Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5.
      ]. There have been reports that in mouse CXCR4 expression increased in a senescent neutrophil phenotype, which developed just before apoptosis [
      • Martin C.
      • Burdon P.C.
      • Bridger G.
      • Gutierrez-Ramos J.C.
      • Williams T.J.
      • Rankin S.M.
      Chemokines acting via CXCR2 and CXCR4 control the release of neutrophils from the bone marrow and their return following senescence.
      ,
      • Summers C.
      • Rankin S.M.
      • Condliffe A.M.
      • Singh N.
      • Peters A.M.
      • Chilvers E.R.
      Neutrophil kinetics in health and disease.
      ]. CXCR4 high expressing cells preferentially home to the bone marrow where they are cleared by resident stromal macrophages [
      • Furze R.C.
      • Rankin S.M.
      Neutrophil mobilization and clearance in the bone marrow.
      ]. Our data suggested that RvD1 can promote polymorphonuclear leukocyte senescence and it accelerates neutrophils in BALF back to bone marrow at 24 h. The finding was consistent with the low levels of CXCL-12 expression, lessening neutrophils migration, and retention in alveolar.
      In the later stage of acute inflammation, RvD1 decreased the level of CXCR4 on neutrophil, as well as CXCL-12 mRNA expression in lung tissue. The effect of RvD1 was consistent with AMD3100, a CXCL-12/CXCR4 blocker. These results indicated that the effect of RvD1 on CXCL-12/CXCR4 changed as the progress of inflammation. Maybe CXCL-12 plays a major role in regulating neutrophil migration and retention in alveolar space compared with its receptor.
      There have been reports on that RvD1 can lessen neutrophil accumulation in inflamed lung tissue by inhibiting neutrophil–platelet heterotypic interactions and can alleviate LPS-induced ALI [
      • Eickmeier O.
      • Seki H.
      • Haworth O.
      • et al.
      Aspirin-triggered resolvin D1 reduces mucosal inflammation and promotes resolution in a murine model of acute lung injury.
      ,
      • Wang B.
      • Gong X.
      • Wan J.Y.
      • et al.
      Resolvin D1 protects mice from LPS-induced acute lung injury.
      ]. These researches focus on neutrophil-platelets and neutrophil-endothelial interactions. In the present study, we investigated RvD1 on reducing neutrophil number in alveolar space from another two moleculars: CXCL-12 and CXCR4. CXCL-12/CXCR4 regulates neutrophil movement mainly in bone marrow. RvD1 can suppress CXCL-12 production and regulate CXCR4 expression bidirectionally. These data indicated that RvD1 protected LPS-induced ALI through multiple pathways except the main inflammatory pathway (such as mitogen-activated protein kinase and nuclear factor-kappa B). It can be anticipated that CXCL-12/CXCR4 axis is a target of RvD1 in inflammatory diseases and RvD1 may produce other functions through this signal pathway. Furthermore, AMD3100, an antagonist of CXCR4, attenuated LPS-induced ALI through blocking CXCL-12/CXCR4 pathway.
      There are some liminations in this study: we have just described one tissue that RvD1 acted on stromal cell derived factor 1 /CXCR4 axis, but it is still unknown that whether RvD1 regulates CXCR4 expression on neutrophil in other tissues, such as peripheral circulation and bone marrow. In addition, further research is needed for a better understanding of the specific mechanism of RvD1 on CXCL-12/CXCR4 pathway.

      5. Conclusions

      The results demonstrated that RvD1 can suppress the production of CXCL-12, upregulate CXCR4 level on neutrophils in alveolar space in the early stage of inflammation and reduce CXCR4 expression on neutrophils in alveolar space as inflammation exacerbating. Therefore, it is indicated that CXCL-12/CXCR4 pathway is another therapeutic target of RvD1 in inflammatory diseases, especially in ALI.

      Acknowledgment

      This study was supported by the Research Fund for the Doctoral Program of Higher Education of China (no.20100142120035).

      References

        • Matthay M.A.
        • Zimmerman G.A.
        Acute lung injury and the acute respiratory distress syndrome: four decades of inquiry into pathogenesis and rational management.
        Am J Respir Cell Mol Biol. 2005; 33: 319
        • Reutershan J.
        • Ley K.
        Bench-to-bedside review: acute respiratory distress syndrome - how neutrophils migrate into the lung.
        Crit Care. 2004; 8: 453
        • Sun B.
        • Sun H.
        • Liu C.
        • Shen J.
        • Chen Z.
        • Chen X.
        Role of CO-releasing molecules liberated CO in attenuating leukocytes sequestration and inflammatory responses in the lung of thermally injured mice.
        J Surg Res. 2007; 139: 128
        • Borregaard N.
        Neutrophils, from marrow to microbes.
        Immunity. 2010; 33: 657
        • Petty J.M.
        • Sueblinvong V.
        • Lenox C.C.
        • et al.
        Pulmonary stromal-derived factor-1 expression and effect on neutrophil recruitment during acute lung injury.
        J Immunol. 2007; 178: 8148
        • Yamada M.
        • Kubo H.
        • Kobayashi S.
        • et al.
        The increase in surface CXCR4 expression on lung extravascular neutrophils and its effects on neutrophils during endotoxin-induced lung injury.
        Cell Mol Immunol. 2011; 8: 305
        • Lukacs N.W.
        • Berlin A.
        • Schols D.
        • Skerlj R.T.
        • Bridger G.J.
        AMD3100, a CXCR4 antagonist, attenuates allergic lung inflammation and airway hyperreactivity.
        Am J Pathol. 2002; 160: 1353
        • Song J.S.
        • Kang C.M.
        • Kang H.H.
        • et al.
        Inhibitory effect of CXC chemokine receptor 4 antagonist AMD3100 on bleomycin induced murine pulmonary fibrosis.
        Exp Mol Med. 2010; 42: 465
        • Levy B.D.
        Resolvins and protectins: natural pharmacophores for resolution biology.
        Prostaglandins Leukot Essent Fatty Acids. 2010; 82: 327
        • Norling L.V.
        • Dalli J.
        • Flower R.J.
        • Serhan C.N.
        • Perretti M.
        Resolvin D1 limits polymorphonuclear leukocyte recruitment to inflammatory loci: receptor-dependent actions.
        Arterioscler Thromb Vasc Biol. 2012; 32: 1970
        • Chiang N.
        • Fredman G.
        • Bäckhed F.
        • et al.
        Infection regulates pro-resolving mediators that lower antibiotic requirements.
        Nature. 2012; 484: 524
        • Serhan C.N.
        • Hong S.
        • Gronert K.
        • et al.
        Resolvins: a family of bioactive products of omega-3 fatty acid transformation circuits initiated by aspirin treatment that counter proinflammation signals.
        J Exp Med. 2002; 196: 1025
        • Sun Y.P.
        • Oh S.F.
        • Uddin J.
        • et al.
        Resolvin D1 and its aspirin-triggered 17R epimer. Stereochemical assignments, anti-inflammatory properties, and enzymatic inactivation.
        J Biol Chem. 2007; 282: 9323
        • Eickmeier O.
        • Seki H.
        • Haworth O.
        • et al.
        Aspirin-triggered resolvin D1 reduces mucosal inflammation and promotes resolution in a murine model of acute lung injury.
        Mucosal Immunol. 2013; 6: 256
        • Bannenberg G.L.
        • Chiang N.
        • Ariel A.
        • et al.
        Molecular circuits of resolution: formation and actions of resolvins and protectins.
        J Immunol. 2005; 174: 4345
        • Krishnamoorthy S.
        • Recchiuti A.
        • Chiang N.
        • et al.
        Resolvin D1 binds human phagocytes with evidence for proresolving receptors.
        Proc Natl Acad Sci U S A. 2010; 107: 1660
        • Liao Z.
        • Dong J.
        • Wu W.
        • et al.
        Resolvin D1 attenuates inflammation in lipopolysaccharide-induced acute lung injury through a process involving the PPARγ/NF-κB pathway.
        Respir Res. 2012; 13: 110
        • Wang B.
        • Gong X.
        • Wan J.Y.
        • et al.
        Resolvin D1 protects mice from LPS-induced acute lung injury.
        Pulm Pharmacol Ther. 2011; 24: 434
        • Matute-Bello G.
        • Downey G.
        • Moore B.B.
        • et al.
        An official American Thoracic Society workshop report: features and measurements of experimental acute lung injury in animals.
        Am J Respir Cell Mol Biol. 2011; 44: 725
        • Ferretti S.
        • Bonneau O.
        • Dubois G.R.
        • Jones C.E.
        • Trifilieff A.
        IL-17, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophilia: IL-15 as a possible trigger.
        J Immunol. 2003; 170: 2106
        • Harris J.F.
        • Aden J.
        • Lyons C.R.
        • Tesfaigzi Y.
        Resolution of LPS-induced airway inflammation and goblet cell hyperplasia is independent of IL-18.
        Respir Res. 2007; 8: 24
        • Allen C.D.
        • Ansel K.M.
        • Low C.
        • et al.
        Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5.
        Nat Immunol. 2004; 5: 943
        • Martin C.
        • Burdon P.C.
        • Bridger G.
        • Gutierrez-Ramos J.C.
        • Williams T.J.
        • Rankin S.M.
        Chemokines acting via CXCR2 and CXCR4 control the release of neutrophils from the bone marrow and their return following senescence.
        Immunity. 2003; 19: 583
        • Summers C.
        • Rankin S.M.
        • Condliffe A.M.
        • Singh N.
        • Peters A.M.
        • Chilvers E.R.
        Neutrophil kinetics in health and disease.
        Trends Immunol. 2010; 31: 318
        • Furze R.C.
        • Rankin S.M.
        Neutrophil mobilization and clearance in the bone marrow.
        Immunology. 2008; 125: 281

      Linked Article