If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Corresponding author. Department of General Surgery, Xiangya Hospital, Central South University, Changsha 410008, Hunan, China. Tel.:+86 731 8975 3008.
Our previous work described a metastasis-related microRNAs expression profiling and revealed miR-503 regulating metastatic function in hepatocellular carcinoma (HCC) cells. Here, we investigate to define the mechanism of miR-503 regulating metastasis in HCC.
Materials and methods
The expressions of miR-503 in HCC cell lines and clinical tissues with different metastatic potential were investigated. Meanwhile, a metastatic human HCC cell BALB/c nude mice model was used to investigate whether miR-503 regulates metastasis of HCC in vivo. Furthermore, luciferase activity of reporter gene, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), fluorescence-activated cell sorting analysis (FACS), and invasion assay were carried out to characterize the mechanism of miR-503 regulating metastasis in HCC.
Results
We confirmed the negative correlation between miR-503 expression and metastatic potential of HCC in cell lines and in clinical HCC tissues. We also showed that overexpression of miR-503 resulted in inhibition of proliferation and metastasis of HCC in vivo. Furthermore, we demonstrated that ARHGEF19 is a direct target gene of miR-503. Finally, our results indicated that ARHGEF19 overcomes the suppressive influence of miR-503 in HCC cells.
Conclusions
Our results suggest an important role of miR-503 in inhibiting metastasis of HCC through deregulating ARHGEF19.
]. During the past decade, the long-term survival of HCC remains unsatisfactory because of a high incidence of recurrence and metastasis after the hepatic resection, with a 5-y actuarial recurrence rate of 75%–100% reported in the literature [
]. Metastasis is a complex process by which primary tumor cells invade adjacent tissue, enter systemic circulation, arrest in distant capillaries and finally proliferate into secondary tumors [
]. Our previous investigations focused on the differentially expressed genes, such as ras homolog gene family, member C, Wiskott-Aldrich syndrome protein family verprolin-homologous protein 2, vascular endothelial growth factor, which involved in invasion and metastasis of HCC [
Elevated expression of autocrine motility factor receptor correlates with overexpression of RhoC and indicates poor prognosis in hepatocellular carcinoma.
Increased expression of Wiskott-Aldrich syndrome protein family verprolin-homologous protein 2 correlated with poor prognosis of hepatocellular carcinoma.
]. However, because of the complex molecular mechanism of metastasis, none of these specific genes alone can explain the metastasis of HCC. Therefore, the development of new approaches for better understanding the metastasis of HCC is anticipated.
MicroRNAs (miRNAs), a noncoding RNA family, are 19- to 25-nt transcripts that play a key regulatory role in messenger RNA translation and degradation. Although the precise biological function of miRNAs is not yet fully understood, their diverse expression patterns may regulate various developmental and physiological processes [
]. Each miRNA has a distinct capability to potentially regulate the expression of hundreds of coding genes and thereby modulate several cellular pathways including proliferation, apoptosis, invasion, and migration. In fact, the study of miRNAs is advantageous in improving our understanding of the mechanisms of cancer invasion and metastasis [
]. Actually, in our previous study, the miRNA microarray technology was used to profile miRNAs expression patterns in two HCC cell lines with differently spontaneous metastatic potential. Among these miRNAs differentially expressed between the cell lines, miR-503 was identified as a potential and important miRNA regulating the metastatic function in hepatocellular cancer cell [
]. However, the detailed mechanism of miR-503 regulating metastatic function in HCC remains unknown. Here, we investigate the mechanism of miR-503 in HCC metastasis. Furthermore, we sought to determine whether overexpression of miR-503 could block the metastasis of HCC in vivo.
2. Materials and methods
2.1 Cell lines and clinical HCC tissue specimens
The study protocol was approved by the Ethics Committee of the Xiangya hospital, Central South University (CSU). HCCLM3 and MHCC97-L cell lines, two HCC cell lines with differently metastatic potential, were obtained from Liver Cancer Institute and Zhong Shan Hospital of Fudan University. MHCC97-L cells exhibited a low metastatic potential, whereas HCCLM3 cells were highly invasive as demonstrated by extensive metastasis via both subcutaneous and orthotopic inoculation [
]. The fresh HCC tissues and paired liver tissues were obtained from 33 (29 male and 4 female) patients with primary HCC who underwent hepatectomy at Xiangya Hospital of CSU. The median age of these patients was 52 y, ranging from 28–78 y. All specimens were confirmed by pathologic examination. Thirty-three samples of HCC included 14 samples with metastasis (including 11 cases of lymph node metastasis lesions) and 19 samples without metastasis.
2.2 Real-time polymerase chain reaction assays
Total RNA was obtained from cell lines and tissue samples as previously described [
]. The reverse transcription was performed on Gene Amp polymerase chain reaction (PCR) System 9700 (ABI; Applied Biosystems, CA). The primer sequences for reverse transcription were the following: hsa-mir-503, 5′ GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTGCAGA3’; U6, 5′CGCTTCACGAATTTGCGTGTCAT3’. The real-time PCR was performed on Rotor-Gene 3000 real-time PCR (Corbett Research), the primer and the size of production were the following: hsa-miR-503: GSP: 5′GGTAGCAGCGGGAACAGT3', R18: 5′ GTGCGTGTCGTGGAGTCG 3′, size: 63 bp; ARHGEF19: F:5′GGAGGCTCGAAGTGTAGAGAT3’; R:5′CCAATCGCCCTCTCGTGAG3’, size: 76 bp. U6: F:5′GCTTCGGCAGCACATATACTAAAAT3’; R:5′CGCTTCACGAATTTGCGTGTCAT3’, size: 89 bp. The results were analyzed by using 2−△△computed tomography method.
2.3 Plasmid construction and transduction
To construct pre-miR503 expression vector, we first amplified a 100-base-pair miRNA precursor sequence with primer 5′- CGGGTACCGGTGCCCTAGCAGCGGGAACAGTTCTGCAGTGAGCGATCGGTG-3′ and 5′- CCGGAATTCTACCCTGGCAGCGGAAACAATACCCCAGAGCACCGATCGCTCACTGCAG-3′. The amplified fragment was digested and cloned into a pGCSIL-green fluorescent protein (GFP) lentivirus expression vector (Genechem corporation, Shanghai, China) containing a cytomegalovirus driven enhanced GFP reporter gene and a U6 promote. The positive clones were identified by PCR reaction with the following primer: 5′-CCTATTTCCCATGATTCCTTCATA-3′ and 5′-GTAATACGGTTATCCACGCG-3′. All PCR products were verified by sequence analysis. The pre-miR503 recombinant lentivirus was produced by cotransfecting 293 T cells with the help of Lipofectamine2000 (Invitrogen, Carlsbad, CA) according to the standard protocol. Virus titer was determined by measuring GFP expression in 293 T cell. For transduction, HCCLM3 cells were infected with either control lentivirus or pre-miR503 lentivirus. After 48 h of transduction, the cells were harvested and prepared for subsequent study [
2.4 The ARHGEF19 expression and ARHGEF19 3′-untranslated region luciferase reporter analysis
For expression of ARHGEF19 protein in HCC cell, the ARHGEF19 ready-to-use expression vector tagged with C-terminal green fluorescent protein (GFP) (Origene, Rockville, MD) was used. The ARHGEF19 expression vector was transiently transfected with Lipofectamine2000 into HCC cells following the protocol. For luciferase activity assay, the 3′-untranslated region (UTR) of ARHGEF19 (wild type, UTR-WT) was PCR-amplified using ARHGEF19 (NM_153213) Human complementary DNA Open Reading Frame Clone (Origene) as a template and subcloned into pmirGlo vector downstream of the firefly luciferase expression cassette (Promega, Madison, WI). The QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to generate the ARHGEF19 3′-UTR variants (UTR-mut) where seed sequences that are recognized by miR-503 were deleted. The pmirGlo reporter plasmids (1 μg total plasmid amount) were transfected with Lipofectamine2000 into the HCC cells. Cells were collected after 48 h for assay using the Dual-Luciferase Reporter Assay System (Promega) [
Cells were lysed in a lysis buffer (Pierce, Rockford, IL). Total protein was separated and transferred to polyvinylidene fluoride membrane (Invirtogen). The membrane was incubated with primary antibody (goat anti-ARHGEF19 polyclonal antibody, diluted at 1:1000; Santa Cruz, CA), followed by incubation with a 1:1000 dilution of horseradish peroxidase-linked rabbit anti-goat antibody (Santa Cruz). Then the membrane was treated with Western blotting luminal reagent (Pierce) to visualize the bands.
2.6 Invasion and migration assay
For invasion assay, cell invasion assay kit (Chemicon international, Inc, Temecula, CA) was used and performed following the protocol. Three invasion chambers were used per condition. The value obtained was calculated by averaging the total number from three filters. For migration assay, wound-healing assay was performed. 200 μL of cell suspension at 2 × 105 cells/mL was added to a 96-well plate, monolayer was then disrupted with a Tip and photographs were taken at 0, 1, 2, and 3 d. Experiments were carried out in triplicate, and four fields of each point were recorded.
2.7 MTT and fluorescence-activated cell sorting analysis
For MTT, HCCLM3 cells were plated in 96-well plates at 3 × 103 per well. After incubation, 10 μL MTT with 5 mg/mL concentration was added to the medium, and cultured for another 4 h, then the medium was discarded and 100 μL of dimethyl sulfoxide was added into each well. The absorbencies of each well were read. The relative cell grown was examined at day 1, 2, 3, 4, and 5. For fluorescence-activated cell sorting (FACS) analysis, after incubation in serum-free media for 24 h, cells were washed with phosphate-buffered saline at 4°C twice, and were modulated concentration to 1 × 106/mL, PI were added for incubation for 30 min. FACS analysis was performed on the FACS caliber instrument (Becton Dickinson, Franklin Lakes, NJ); all experiments were repeated thrice with similar results.
2.8 In vivo
A metastatic human HCC cell BALB/c nude mice model was established as described previously [
Stepwise metastatic human hepatocellular carcinoma cell model system with multiple metastatic potentials established through consecutive in vivo selection and studies on metastatic characteristics.
New human hepatocellular carcinoma (HCC) cell line with highly metastatic potential (MHCC97) and its expressions of the factors associated with metastasis.
]. The whole lung embedded in paraffin was cut into thick slices continuously for H&E staining and the number of metastatic tumor in lung was counted under the microscope as described previously [
]. The histopathologic examination was carried out by pathologist who masked from experimental group designation. All experimental protocols were approved by the Institutional Animal Care and Use Committee, Xiangya Hosptial, CSU.
2.9 Statistical analysis
Statistical analysis was performed using the SPSS (version 11.0, Chicago, IL). Quantitative data in this study were expressed as the mean ± standard deviation from at least three separate experiments performed in triplication, unless otherwise noted. Statistical difference between groups was compared using two-tailed analysis of variance and t-test. A P value <0.05 was considered significant.
3. Results
3.1 Down-expressed miR-503 correlates with increased metastatic potential in HCC cell lines and clinical HCCs
Here we first investigated the expression of miR-503 in HepG2, MHCC97-L, and HCCLM3, three HCC cell lines with increasing spontaneous metastatic potential, to determine whether there is a correlation between miR-503 expression and metastasis potential in HCC cell lines. As shown in Figure 1A, the level of miR-503 in MHCC97-L cells and HCCLM3 cells were much lower than that in HepG2 cells. The HCCLM3 cells showed an approximately 4-fold decreased expression of miR-503 as compared with HepG2 cells (P < 0.01). Next, we examined the expression of miR-503 in clinical liver tissue and HCC tissue. In 33 HCC tissues and paired liver tissues, the expression of miR-503 decreased in HCC tissues as compared with paired liver tissues (Fig. 1B, P < 0.01). Furthermore, as shown in Figure 1C, the expression of miR-503 in 14 cases of HCC tissue with metastasis revealed a decreased expression of miR-503 as compared with 19 cases of HCC tissue without metastasis. Especially, eleven cases of metastatic lymph nodes showed more than a 4-fold decreased expression of miR-503 as compared with their corresponding primary HCC tissue (Fig. 1D, P < 0.01). Collectively, these correlations, consistent with the result in the cell line, indicated that miR-503 might well have a causal role in HCC metastasis.
Fig. 1Down-expressed miR-503 correlates with increased metastatic potential in HCC cell lines and clinical HCCs. (A) The relatively expression of miR-503 in HepG2, MHCC97-L, and HCCLM3 cell lines, three HCC cell lines with increasing spontaneous metastatic potential, were determined by real-time PCR. Columns, mean of three separate experiments; bars, standard deviation; *P < 0.05 versus HCCLM3 cells; **P < 0.05 versus MHCC97-L cells. (B) The relatively expression of miR-503 in clinical HCC tissues and paired liver tissues (N = 33) were examined by real-time PCR respectively. (C) The relatively expression of miR-503 in clinical HCC tissues without metastasis (N = 19) or HCC tissue with metastasis (N = 14) were examined by real-time PCR respectively. (D) The relatively expression of miR-503 in clinical paired primary HCC tissues and metastatic lymph nodes were examined by real-time PCR respectively (N = 11). Data are presented as mean ± standard deviation. N, number of HCC tissues; Columns, mean of each separate experiments; bars, SD; ANOVA and t-test, *P < 0.05.
3.2 miR-503 inhibits HCC proliferation and metastasis in vivo
To address whether miR-503 could inhibit metastatic behavior of HCC in vivo, HCCLM3 cells infected with lentivirus-pre-miR-503 or control lentivirus were subcutaneously transplanted to generate primary HCC tumor, these nude mice model were named as MicemiR503+ and MicemiR503−, respectively [
]. As shown in Figure 2A , difference in the primary tumor size was detected. The primary tumor was smaller in MicemiR503+ than that in MicemiR503− (P < 0.05), which suggested that expression of miR-503 could inhibit growth of HCC. Furthermore, the number of lung metastasis identified and counted by pathologist under microscope, was significantly fewer in MicemiR503+ than that in MicemiR503− (Fig. 2B, P < 0.01). Significantly, these results indicated that miR-503 could inhibit proliferative and metastatic behavior of HCC in vivo.
Fig. 2Expression of miR-503 inhibits proliferation and metastasis of HCCLM3 cells in vivo. A metastatic human HCC cell BALB/c nude mice model was established as described previously [
]. (A) The primary tumor volume (cm3) was examined in mice every 5 d after cell implantation. (B) The whole lung embedded in paraffin was cut into thick slices continuously for H&E staining and the number of metastatic tumor in whole lung was counted under the microscope. Arrow indicated lung metastasis; Data are presented as mean ± standard deviation. Columns, Mean of each experiment for ten mice in each group; bar, SD; ANOVA and t-test, *P < 0.05 versus MicemiR503−. (Color version of figure is available online.)
To understand the mechanism of miR-503 regulating tumor metastasis, several computational methods were used to identify miR-503 target genes in human. Among hundreds of target gene predicted by TargetScan search program, ARHGEF19 was of particular interest (Fig. 3A ), because it can activate ras homolog gene family, member C, which has been previously implicated as strong promoter for metastasis for HCC [
Elevated expression of autocrine motility factor receptor correlates with overexpression of RhoC and indicates poor prognosis in hepatocellular carcinoma.
]. We first investigate the expression of ARHGEF19 and miR-503 in HCC cell lines simultaneously. As shown in Figure 3B, the mRNA levels of ARHGEF19 in HCCLM3 and MHCC97-L were much higher than that in HepG2, with an approximately five-fold increasing (P < 0.01), this crosscurrent compared with miR-503 indicated the possibility of negative regulation by miR-503. To verify the direct regulation of miR-503 to ARHGEF19, luciferase activity of ARHGEF19 3′UTR reporter gene was used. As shown in Figure 3C, luciferase activity of ARHGEF19 3′UTR reporter in LV-miR-503 HCCLM3 cells decreased significantly as compared with in LV-control HCCLM3 cells (P < 0.01). Meanwhile, the effect was abolished within the ARHGEF19 3′-UTR variants. Furthermore, to support this result, we examine the ARHGEF19 protein expression in LV-miR-503 HCCLM3 cell, a reduction in the level of the endogenous ARHGEF19 protein in LV-miR-503 HCCLM3 cells as compared with LV-control HCCLM3 cells was observed (P < 0.01, Fig. 3D).
Fig. 3ARHGEF19 is a direct target of miR-503. (A) Scheme and sequence of human ARHGEF19 3′UTR for miR-503 binding site (wild type). (B) The expression of miR-503 and ARHGEF19 in HepG2, MHCC97-L and HCCLM3 cells were determined by real-time PCR respectively. Columns, mean of three separate experiments; bars, SD, *P < 0.05 versus HepG2 cells and **P < 0.05 versus MHCC97-L cells. (C) Luciferase activity of ARHGEF19 3′-UTR reporter vector (UTR-WT) and ARHGEF19 3′-UTR variants (UTR-mut) reporter vector transfected into LV-miR503 HCCLM3 cells or LV-control HCCLM3 cells were determined. Columns, mean of three separate experiments; bars, SD; *P < 0.05 versus LV-control HCCLM3 cells. (D) The miR-503 and ARHGEF19 protein expressions were determined by relative real time PCR and Western blot respectively. Columns, mean of three separate experiments; bars, SD; ANOVA and t-test, *P < 0.05 and **P < 0.01 versus LV-control HCCLM3 cells, respectively.
3.4 ARHGEF19 overcomes the suppressive influence of miR-503 in HCCLM3 cells
We further question whether ARHGEF19 is a functional target of miR-503. As we have demonstrated that miR-503 inhibits proliferation and metastasis of HCCLM3 cell in vitro previously [
], we hypothesized that this inhibition might be prevented through expressing ARHGEF19 in vitro. Here, ARHGEF19 expression vector and control vector were constructed and transiently transfected into the LV-miR503 HCCLM3 cell respectively. As shown in Figure 4A, proliferation was partially inhibited in HCCLM3 cells infected with LV-miR-503. However, this inhibition can be reversed by transfected with ARHGEF19 expression vector partly. The proliferation rate at day 5 in LV-miR-503 HCCLM3 cells transfected with ARHGEF19 expression vector increased about 29% as compared with HCCLM3 cells transfected with control vector (P < 0.05). Furthermore, flow cytometric analysis revealed that number of cells in S phase increased and cells in G1 decreased after cells transfected with ARHGEF19 expression vector, which suggested that miR-503 inducing G1 arrest could be blocked by overexpression of ARHGEF19 (Fig. 4B).
Fig. 4ARHGEF19 overcomes the suppressive influence of miR-503 in HCCLM3 cells. Legend: Control: HCCLM3 cells without infection; LV-Control: HCCLM3 cells infected with Lentivirus-Control; LV-miR-503: HCCLM3 cells infected with lentivirus-pre-miR-503; LV-miR-503 + Control: HCCLM3 cells infected with lentivirus-pre-miR-503 and transiently transfected with Control vectors; LV-miR-503 + ARHGEF19: HCCLM3 cells infected with lentivirus-pre-miR-503 and transiently transfected with ARHGEF19 ready-to-use expression vectors. (A) MTT assay, the relative cell grown was examined at day 1, 2, 3, 4, and 5. Points, mean of three separate experiments; bars, SD. (B) FACS analysis was performed on the FACS caliber instrument. All experiments were repeated thrice with similar results. (C) Migration assay, photographs were taken at 0, 1, 2, and 3 d. Experiments were carried out in triplicate, and four fields of each point were recorded. (D) For invasion assay, cell invasion assay kit was used according to the manufacturer's instruction. Three invasion chambers were used per condition. The values obtained were calculated by averaging the total number from three filters. Columns, mean of three separate experiments; bars, SD; ANOVA and t-test, *P < 0.05 versus LV-miR-503 + Control. (Color version of figure is available online.)
Next, we investigated the role of ARHGEF19 in the invasion and metastasis regulated by miR-503. Anticipatively, as shown in Figure 4C, LV-miR-503 HCCLM3 cells transfected with ARHGEF19 expression vector exhibited more than double increase in closure as compared with cells transfected with control vector (P < 0.05), suggesting a role for ARHGEF19 in the migration of HCCLM3 cells regulated by miR-503. To substantiate this observation, a matrigel invasion assay in transwell culture chamber was performed to determine the role of ARHGEF19 in the invasion of HCCLM3 cells regulated by miR-503 in vitro. As shown in Figure 4D, the number of LV-miR503 HCCLM3 cells transfected with ARHGEF19 expression vector that passed through matrigel increased 92% as compared with those cells transfected with control vector (P < 0.05). Together, these results support a crucial role of ARHGEF19 in the invasion of HCCLM3 cells regulated by miR-503.
4. Discussion
Here, we examined the expression of miR-503 in HCC cell lines with different metastatic potential and clinical HCC tissues simultaneously. In our study, three HCC cell lines with differently spontaneous metastatic potential, HepG2, MHCC97-L and HCCLM3, were used. MHCC97-L cells exhibited a low metastatic potential, whereas HCCLM3 cells were highly invasive as demonstrated by extensive metastases via both subcutaneous and orthotopic inoculation [
Stepwise metastatic human hepatocellular carcinoma cell model system with multiple metastatic potentials established through consecutive in vivo selection and studies on metastatic characteristics.
New human hepatocellular carcinoma (HCC) cell line with highly metastatic potential (MHCC97) and its expressions of the factors associated with metastasis.
], these three cell lines, together with 33 cases of clinic HCC sample with or without metastatic lesion and paired liver tissues, were used to investigate the correlation between miR-503 expression and HCC metastasis. Anticipatively, these results suggested a direct correlation between expression of miR-503 and metastatic potential in HCC. We also used a metastatic human HCC cell BALB/c nude mice model to investigate whether overexpression of miR-503 could inhibit the metastasis of HCC in vivo. This result, according with our previous results, demonstrated that overexpression of miR-503 inhibits HCC metastasis. To the best of our knowledge, this is the first time to report that overexpression of miR-503 in vivo could inhibit the metastaisis of HCC.
Each miRNA is believed to directly bind and regulate the translation or stability of many target mRNAs. Recognizing these gene targets is essential before interfering with miRNA expression for therapeutic purpose. With the help of target prediction software program, we identified many potential target genes of miR-503. In those predicted target genes, ARHGEFs attract our attention because our previous study had demonstrated that small GTPases play important role in the HCC metastasis [
Elevated expression of autocrine motility factor receptor correlates with overexpression of RhoC and indicates poor prognosis in hepatocellular carcinoma.
]. ARHGEFs, as a guanine nucleotide exchange factors (GEFs), catalyze the release of GDP on small GTPases in exchange for GTP and activate small GTPases [
]. For this reason, we make a hypothesis that there is a miR-503/ARHGEF19/Rho pathway in the metastasis of HCC. Our luciferase activity of ARHGEF19 3′UTR reporter assay identified that ARHGEF19 is a direct target gene of miR-503. Furthermore, the crosscurrent expression of miR-503 and ARHGEF19 also supported our hypothesis. Actually, when the ARHGEF19 expression vector was transiently transfected into the LV-miR503 HCCLM3 cells, the proliferation, which was inhibited in HCCLM3 cells infected with LV-miR-503, can be reversed partly. The similar result was observed in wound-healing assay and matrigel invasion assay. Collectively, these results support a crucial role for ARHGEF19 in the invasion of HCCLM3 cells regulated by miR-503. Actually, recent document has reported that miR-503 and cdc25, a small GTPase, expressed inversely in human limb muscle of diabetic patients [
Deregulation of microRNA-503 contributes to diabetes mellitus-induced impairment of endothelial function and reparative angiogenesis after limb ischemia.
We have demonstrated a crucial role of miR-503 in inhibition for metastasis of HCC through ARHGEF19. The finding of this study highlights important clinical implication of miR-503 in metastasis of HCC.
Acknowledgment
No potential conflicts of interest were disclosed.
This work was supported by the National Natural Science Foundation of China (No. 30801388).
Elevated expression of autocrine motility factor receptor correlates with overexpression of RhoC and indicates poor prognosis in hepatocellular carcinoma.
Increased expression of Wiskott-Aldrich syndrome protein family verprolin-homologous protein 2 correlated with poor prognosis of hepatocellular carcinoma.
Stepwise metastatic human hepatocellular carcinoma cell model system with multiple metastatic potentials established through consecutive in vivo selection and studies on metastatic characteristics.
New human hepatocellular carcinoma (HCC) cell line with highly metastatic potential (MHCC97) and its expressions of the factors associated with metastasis.
Deregulation of microRNA-503 contributes to diabetes mellitus-induced impairment of endothelial function and reparative angiogenesis after limb ischemia.
02171-9&id=gr1.jpg){kind=link}
02171-9&id=gr2.jpg){kind=link}
02171-9&id=gr3.jpg){kind=link}
02171-9&id=gr4.jpg){kind=link}