Advertisement

Diosmetin protects against ischemia/reperfusion-induced acute kidney injury in mice

Open AccessPublished:March 05, 2017DOI:https://doi.org/10.1016/j.jss.2017.02.067

      Abstract

      Background

      Renal ischemia/reperfusion (I/R)-induced acute kidney injury remains to be a troublesome condition in clinical practice. Although the exact molecular mechanisms underlying renal I/R injury are incompletely understood, the deleterious progress of renal I/R injury involves inflammation, apoptosis, and oxidative stress. Diosmetin is a member of the flavonoid glycosides family, which suppresses the inflammatory response and cellular apoptosis and enhances antioxidant activity. The purpose of this study was to investigate the protective effect of diosmetin on I/R-induced renal injury in mice.

      Methods

      Thirty BALB/c mice were randomly divided into five groups. Four groups of mice received diosmetin (0.25, 0.5, and 1 mg/kg) or vehicle (I/R group) before ischemia. Another group received vehicle without ischemia to serve as a negative control (sham-operated group). Twenty-four hours after reperfusion, serum and renal tissues were harvested to evaluate renal function and histopathologic features. In addition, the expression of inflammation-related proteins, apoptotic molecules, and antioxidant enzymes was analyzed.

      Results

      Compared with sham mice, the I/R group significantly exacerbated renal function and renal tube architecture and increased the inflammatory response and renal tubule apoptosis. Nevertheless, pretreatment with diosmetin reversed these changes. In addition, diosmetin treatment resulted in a marked increase in antioxidant protein expression compared with I/R mice.

      Conclusions

      The renoprotective effects of diosmetin involved suppression of the nuclear factor-κB and mitochondrial apoptosis pathways, as well as activation of the nuclear factor erythroid 2–related factor 2/heme oxygenase-1 pathway. Diosmetin has significant potential as a therapeutic intervention to ameliorate renal injury after renal I/R.

      Keywords

      Introduction

      Acute kidney injury (AKI) induced by renal ischemia/reperfusion is characterized by a sudden decline in kidney function that results in high morbidity and mortality.
      • Lameire N.H.
      • Bagga A.
      • Cruz D.
      • et al.
      Acute kidney injury: an increasing global concern.
      Renal ischemia/reperfusion (I/R) injury induces a wide range of deleterious effects such as renal tissue inflammation, tubular epithelial apoptosis, and microvascular disruption.
      • Murugan R.
      • Kellum J.A.
      Acute kidney injury: what's the prognosis?.
      • Andreucci M.
      • Faga T.
      • Pisani A.
      • et al.
      Acute kidney injury by radiographic contrast media: pathogenesis and prevention.
      Aside from renal replacement and supportive treatments, there are no specific therapeutics available to patients.
      • Bellomo R.
      • Kellum J.A.
      • Ronco C.
      Acute kidney injury.
      Therefore, a new therapeutic strategy is urgently needed to search for preserving renal impairment and functional decline after AKI.
      During renal I/R, the inflammatory response stimulates a series of deleterious events that result in kidney tissue injury and renal dysfunction.
      • Bonventre J.V.
      • Yang L.
      Cellular pathophysiology of ischemic acute kidney injury.
      It is well established that the nuclear factor-κB (NF-κB) signaling pathway plays a pivotal role in inflammation by modulating proinflammatory cytokine release.
      • Tak P.P.
      • Firestein G.S.
      NF-kappaB: a key role in inflammatory diseases.
      It has been reported that activation of p65 stimulates downstream genes (interleukin-1β [IL-1β], IL-6 and tumor necrosis factor-α [TNF-α]), which induces leukocytes infiltration and cytokine secretion to further promote the inflammatory response.
      • Kanagasundaram N.S.
      Pathophysiology of ischaemic acute kidney injury.
      Activation of the NF-κB pathway increased expression of several proinflammatory cytokines, including macrophage inflammatory protein-2, IL-1β, and TNF-α, leading to exacerbation of I/R injuries in rat liver transplants.
      • Ramachandran S.
      • Liaw J.M.
      • Jia J.
      • et al.
      Ischemia-reperfusion injury in rat steatotic liver is dependent on NFkappaB P65 activation.
      Moreover, the central subunit of the NF-κB signaling pathway, p65, could induce expression of apoptosis-related proteins and further exacerbate the progression of renal tubule injury and eventual cell death.
      • Ghosh S.
      • Hayden M.S.
      New regulators of NF-kappaB in inflammation.
      The translocation of p65 activates caspase-3 and subsequently activates the caspase cascade, resulting in apoptosis.
      • Martinon F.
      • Holler N.
      • Richard C.
      • et al.
      Activation of a pro-apoptotic amplification loop through inhibition of NF-κB-dependent survival signals by caspase-mediated inactivation of RIP.
      Several studies reported that inhibition of p65 could produce antiapoptosis effects through decreasing expression of Bax and caspase family-related proteins.
      • Lin M.
      • Li L.
      • Li L.
      • et al.
      The protective effect of baicalin against renal ischemia-reperfusion injury through inhibition of inflammation and apoptosis.
      • Ka S.O.
      • Hwang H.P.
      • Jang J.H.
      • et al.
      The protein kinase 2 inhibitor tetrabromobenzotriazole protects against renal ischemia reperfusion injury.
      • Guo S.X.
      • Fang Q.
      • You C.G.
      • et al.
      Effects of hydrogen-rich saline on early acute kidney injury in severely burned rats by suppressing oxidative stress induced apoptosis and inflammation.
      Nuclear factor erythroid 2–related factor 2 (Nrf2), a master transcriptional regulator of antioxidant proteins, is normally deactivated by interacting with the Kelch-like ECH-associated protein 1-Cul3 complex (Keap-1) in the cytoplasm.
      • Jiang T.
      • Tian F.
      • Zheng H.
      • et al.
      Nrf2 suppresses lupus nephritis through inhibition of oxidative injury and the NF-kappaB-mediated inflammatory response.
      After cellular insult, it translocates into the nucleus to promote the expression of heme oxygenase-1 (HO-1), NAD(P)H quinone dehydrogenase-1 (NQO-1) and glutathione reductase, which encodes an antioxidant involved in the defense against oxidative stress.
      • Shelton L.M.
      • Park B.K.
      • Copple I.M.
      Role of Nrf2 in protection against acute kidney injury.
      Many studies have shown that the NF-κB and Nrf2 pathways are tightly associated.
      • Jiang T.
      • Tian F.
      • Zheng H.
      • et al.
      Nrf2 suppresses lupus nephritis through inhibition of oxidative injury and the NF-kappaB-mediated inflammatory response.
      • Mahmoud-Awny M.
      • Attia A.S.
      • Abd-Ellah M.F.
      • et al.
      Mangiferin mitigates gastric ulcer in ischemia/reperfused rats: involvement of PPAR-gamma, NF-kappaB and Nrf2/HO-1 signaling pathways.
      • Li W.
      • Suwanwela N.C.
      • Patumraj S.
      Curcumin by down-regulating NF-kB and elevating Nrf2, reduces brain edema and neurological dysfunction after cerebral I/R.
      • Farias J.G.
      • Carrasco-Pozo C.
      • Carrasco Loza R.
      • et al.
      Polyunsaturated fatty acid induces cardioprotection against ischemia-reperfusion through the inhibition of NF-kappaB and induction of Nrf2.
      Jiang et al.
      • Jiang T.
      • Tian F.
      • Zheng H.
      • et al.
      Nrf2 suppresses lupus nephritis through inhibition of oxidative injury and the NF-kappaB-mediated inflammatory response.
      reported that Nrf2 protects against lupus nephritis by inhibiting the activation of the NF-κB pathway. After exposure to cerebral, hepatic, and gastric I/R injury, Nrf2 transactivated downstream gene expression, which in turn suppressed the proinflammatory NF-κB pathway.
      • Hua K.
      • Sheng X.
      • Li T.T.
      • et al.
      The edaravone and 3-n-butylphthalide ring-opening derivative 10b effectively attenuates cerebral ischemia injury in rats.
      • Rao J.
      • Qian X.
      • Li G.
      • et al.
      ATF3-mediated NRF2/HO-1 signaling regulates TLR4 innate immune responses in mouse liver ischemia/reperfusion injury.
      • Mahmoud-Awny M.
      • Attia A.S.
      • Abd-Ellah M.F.
      • et al.
      Mangiferin mitigates gastric ulcer in ischemia/reperfused rats: involvement of PPAR-gamma, NF-kappaB and Nrf2/HO-1 signaling pathways.
      Diosmetin (3′,5,7-trihydroxy-4′-methoxyflavone, Fig. 1) is extracted from the traditional Chinese herb Galium verum L. and belongs to the flavonoid family. Flavonoids function to protect blood vessel walls.
      • Zhao R.
      • Chen Z.
      • Jia G.
      • et al.
      Protective effects of diosmetin extracted from Galium verum L. on the thymus of U14-bearing mice.
      Previous studies have demonstrated that diosmetin could be used as a treatment for several diseases such as pancreatitis,
      • Yu G.
      • Wan R.
      • Yin G.
      • et al.
      Diosmetin ameliorates the severity of cerulein-induced acute pancreatitis in mice by inhibiting the activation of the nuclear factor-kappaB.
      asthma,
      • Ge A.
      • Liu Y.
      • Zeng X.
      • et al.
      Effect of diosmetin on airway remodeling in a murine model of chronic asthma.
      and hepatocellular carcinoma.
      • Liu J.
      • Wen X.
      • Liu B.
      • et al.
      Diosmetin inhibits the metastasis of hepatocellular carcinoma cells by downregulating the expression levels of MMP2 and MMP9.
      • Liu B.
      • Shi Y.
      • Peng W.
      • et al.
      Diosmetin induces apoptosis by upregulating p53 via the TGF-beta signal pathway in HepG2 hepatoma cells.
      Diosmetin has been shown to alleviate inflammatory cell infiltration and repress the NF-κB signaling pathway.
      • Ge A.
      • Liu Y.
      • Zeng X.
      • et al.
      Effect of diosmetin on airway remodeling in a murine model of chronic asthma.
      • Yu G.
      • Wan R.
      • Yin G.
      • et al.
      Diosmetin ameliorates the severity of cerulein-induced acute pancreatitis in mice by inhibiting the activation of the nuclear factor-kappaB.
      In addition, the effects of diosmetin upregulate p53 and death receptor 5 to induce cellular apoptosis.
      • Liu B.
      • Shi Y.
      • Peng W.
      • et al.
      Diosmetin induces apoptosis by upregulating p53 via the TGF-beta signal pathway in HepG2 hepatoma cells.
      • Ren Y.
      • Yao X.
      • Wang X.
      • et al.
      MP85–12 diosmetin enhances trail-induced apoptosis in renal carcinoma cells through the up-regulation of death receptor 5.
      Another study proved that diosmetin could ameliorate oxidative stress and DNA damage in adriamycin-induced retinal injury.
      • Shen Z.
      • Shao J.
      • Dai J.
      • et al.
      Diosmetin protects against retinal injury via reduction of DNA damage and oxidative stress.
      However, little is known about its renoprotective effects during renal I/R injury.
      Based on the aforementioned evidence, we hypothesized that diosmetin may protect the kidney from I/R-induced injury. The present study assessed the effects of diosmetin on murine kidneys after I/R. Moreover, the underlying mechanisms of renal function recovery and morphology were investigated.

      Materials and methods

      Chemical and animal

      Diosmetin (analytical standard) was purchased from Sigma-Aldrich (Hong Kong, China), dissolved in 0.9% sodium chloride containing 2% dimethyl sulfoxide at a concentration of 1 mg/mL and stored at −20°C. Healthy male BALB/c mice (20-25 g) were purchased from the Model Animal Research Center of China Three Gorges University (Yichang, China) and maintained in a specific pathogen-free animal facility at the Experimental Animal Center of China Three Gorges University. All mice involving this study had free access to food and water and were housed in a temperature-controlled facility with 12-h light/dark cycles.
      Renal I/R injury was performed as previously described.
      • Kim M.
      • Kim M.
      • Kim N.
      • et al.
      Isoflurane mediates protection from renal ischemia-reperfusion injury via sphingosine kinase and sphingosine-1-phosphate-dependent pathways.
      • Ham A.
      • Rabadi M.
      • Kim M.
      • et al.
      Peptidyl arginine deiminase-4 activation exacerbates kidney ischemia-reperfusion injury.
      Mice were anesthetized with pentobarbital (50 mg/kg) intraperitoneally, and the left kidney pedicle was clamped with an Atraumatic Schwartz microvessel clamp to induce acute ischemia for 45 min, whereas the right was surgically removed. After the clamp was removed, reperfusion was verified visually by restoration of color. Sham mice underwent a similar surgical procedure without clamping the left kidney pedicle. All mice were sacrificed by cervical dislocation after 24 h of reperfusion. Blood and the left kidney were collected for further analysis. The animal procedures were conducted according to the guidelines of the Institutional Animal Care and Use of China Three Gorges University. The study was approved by the animal ethics committee of Medical College of China Three Gorges University.
      All animals (n = 30) used in this study were randomly allocated into five groups of six as follows: (1) sham group, (2) I/R group, (3) low-dose group: I/R + diosmetin (0.25 mg/kg), (4) moderate-dose group: I/R + diosmetin (0.5 mg/kg), and (5) high-dose group: I/R + diosmetin (1 mg/kg). The drug was injected intraperitoneally 45 min before the induction of renal ischemia. Mice in groups 1 and 2 were injected intraperitoneally with 300 μL of saline vehicle. Diosmetin stock solution (1 mg/mL) was diluted with saline vehicle and adjusted to a volume of 300 μL before injection into mice in groups 3-5.

      Biochemical determinations

      Serum was obtained from blood samples to measure blood urea nitrogen (BUN) and serum creatinine (Scr) by an automatic biochemistry analyzer (Hitachi 7060; Tokyo, Japan) after 24 h of reperfusion.

      Kidney histology

      Kidney tissues were fixed with 4% formalin for 24 h, dehydrated. and embedded in paraffin following routine protocols. Then, 4-μm-thick paraffin sections were stained with hematoxylin and eosin and evaluated in a blind manner by a pathologist. The renal scored injury was co-evaluated by Drs J-F.Y. and C.Y. from the Department of Urology, The First People's Hospital Of Yichang, who provide expert guidance for the score calculation. Five randomly selected fields of each sample were quantitated. To guarantee random selection, the fields for each sample were selected by a freshman from the Medical College of China Three Gorges University who was able to operate the microscope. The degree of tubular injury was graded from 0 to 4 according to tubular epithelial cell swelling, interstitial expansion, and intertubular hemorrhaging at 200 × magnification as follows: 0, no damage; 1, <25%; 2, 25% ∼ 50%; 3, 50% ∼ 75%; and 4, >75%. Five randomly selected fields of each sample were quantitated, and the mean score was calculated.
      • Ka S.O.
      • Hwang H.P.
      • Jang J.H.
      • et al.
      The protein kinase 2 inhibitor tetrabromobenzotriazole protects against renal ischemia reperfusion injury.

      Immunohistochemistry

      Four-micrometer sections were deparaffinized and boiled for 20 min in citrate buffer (pH = 6.0) for antigen retrieval. Endogenous peroxidases of the sections were blocked with 0.3 % hydrogen peroxide (H2O2). Nonspecific adsorption was blocked by 5% bovine serum albumin in phosphate buffer saline. After incubation with the primary antibody against NF-κB p65 (Abcam, Cambridge, MA) at 4°C overnight, the sections were washed and then incubated with horseradish peroxidase-conjugated antirabbit secondary antibody for 30 min at room temperature. Samples were stained with 3,3-diaminobenzidine tetrahydrochloride (DAB; Maixin Biotech, Fuzhou, China) and counterstained with hematoxylin. Finally, the expression area of NF-κB p65 protein was photographed (Olympus, Tokyo, Japan) at 400 × magnification, and the results were analyzed by Image-Pro Plus 6.0 (Media Cybernetics, Rockville, MD). The results were defined as integrated option densities/total areas.

      TUNEL assay

      Apoptosis was detected using a terminal deoxynucleotidyl transferase-mediated digoxigenindeoxyuridine nick-end labeling (TUNEL) assay (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocol. In brief, samples were incubated in equilibration buffer for 5 min, followed by incubation in the labeling reaction reagent for 1 h at 37°C to mark DNA fragments in apoptotic cells. Cell counting was performed at 400× magnification using five randomly selected fields, and the apoptosis index was expressed as the percentage of positive cells in the field. Data were averaged.

      Western blotting

      Kidney sample lysates were prepared with RIPA lysis buffer followed by centrifugation. Western blot analysis of IκBɑ (Santa Cruz, Dallas, TX, 1:500), Nrf2 (Santa Cruz, 1:500), HO-1 (Santa Cruz, 1:1000), NQO-1 (Santa Cruz, 1:1000), Bax (Santa Cruz, 1:1000), Bcl-2 (Santa Cruz, 1:1000), poly (ADP-ribose) (PAR) polymerase-1 (PARP-1) (Santa Cruz, 1:1000), β-actin (Abcam, Cambridge, UK, 1:10,000), Histone H3 (Santa Cruz, 1:500), p-NF-κB p65 (Cusabio, Wuhan, China, 1:500), p-IκBɑ (Cusabio, 1:500), NF-κB p65 (Abcam, Cambridge, UK, 1:1500), and GAPDH (Abcam, Cambridge, UK, 1:10,000) was performed according to standard protocols. The blots were detected by the Immobilon Western Chemiluminescent HRP Substrate Kit (Millipore, MA) followed by exposure to Kodak-X-Omat film (Shanghai, China).

      Real-time quantitative polymerase chain reaction

      Total RNA was extracted using TRIZOL Reagent (Invitrogen, Carlsbad, CA) and reverse transcribed with ReverTra Ace (Toyobo, Dalian, China) to produce complementary DNA. The sequences of the primers listed in Table were used for quantitative real-time polymerase chain reaction (PCR). Real-time PCR was performed using SYBR Green-based detection in a StepOnePlus (ABI, CA) according to the manufacturer's instructions. The relative messenger RNA (mRNA) levels of specific genes were normalized to 18S rRNA levels.
      TablePrimers used in RT-qPCR.
      GeneGenBank accessionForward primer 5′-3′Reverse primer 5′-3′
      IL-1βNM_008361.4CTGTGTAATGAAAGACGGCACACTTGTGAGGTGCTGATGTACCA
      IL-6NM_031168.2GCCAGAGTCCTTCAGAGAGATACAGTCCTTAGCCACTCCTTCTGTGAC
      TNF-αNM_013693.3CTGTAGCCCACGTCGTAGCACCCTTGAAGAGAACCTGGGAGT
      HO-1NM_010442.2CACTTCGTCAGAGGCCTGCTGCCACTGTTGCCAACAGGA
      NQO-1NM_010442.2GGGACATGAACGTCATTCTCTGGGTCTCCTCCCAGACGGTTT
      18S rRNANR_003278GGTCATAAGCTTGCGTTGATTAAGCTACGGAAACCTTGTTACGACTTT
      RT-qPCR = real-time quantitative polymerase chain reaction.

      Statistical analysis

      All data for each group were presented as the mean ± standard error. One-way analysis of variance with a Tukey–Kramer test was performed using Graphpad Prism software, version 5.0 (GraphPad Software Inc, La Jolla, CA), for multiple comparisons. Student's t-test was performed using the statistical package SPSS, version 13.0 (SPSS Inc, Chicago, IL) when two groups were compared. The value of P < 0.05 was considered statistically significant for all tests.

      Results

      Diosmetin protects the kidney against I/R injury

      To assess diosmetin's effect on renoprotection, we detected BUN and blood creatinine (Scr) levels from serum samples. The concentrations of BUN and Scr were significantly increased after renal I/R injury compared with the sham mice (24.44 ± 1.00 versus 5.99 ± 0.65, 135.17 ± 2.34 versus 25 ± 1.91, respectively; Fig. 2A and B). However, treatment with diosmetin before I/R injury elicited a significant dose-dependent decrease in both parameters, implying the beneficial effect of diosmetin on renal function.
      Figure thumbnail gr2
      Fig. 2Diosmetin improves renal function after renal I/R injury. BALB/c mice were administered diosmetin intraperitoneally (0.25 mg/kg, 0.5 mg/kg, 1 mg/kg) prior to renal I/R injury. After 24 h of reperfusion, blood and kidney samples were collected for renal function measurement and morphologic analysis. (A) BUN; (B) Scr; (C) Representative photomicrographs of tissues stained with H&E in five groups. Magnification: 200×. Bar = 100 μm. (D) Quantification of the pathologic score in each group as above. Data are presented as the mean ± SE (n = 6 mice per group).P < 0.05 versus sham; #P < 0.05 versus I/R. H&E = hematoxylin and eosin; SE = standard error. (Color version of figure is available online.)
      Beneficial effects of diosmetin on kidney specimens were evaluated by hematoxylin and eosin staining. Compared with sham mice, the I/R group showed severe damage including extensive renal tube dilation, massive intertubular hemorrhaging, tubular epithelial cell necrosis, and inflammatory cell infiltration. Mice treated with diosmetin before I/R injury had prominently reduced kidney injury compared with the I/R group (Fig. 2C). The tubular injury score results indicated that a high dose of diosmetin (1 mg/kg) before I/R caused significantly decreased tubular dilation and intertubular edema, from 3.67 ± 0.19 to 0.93 ± 0.3 (P < 0.05; Fig. 2D).

      Diosmetin inhibits NF-κB signaling and the proinflammatory response

      Activation of the NF-κB signaling pathway plays an important role in the proinflammatory response after I/R injury.
      • Kusch A.
      • Hoff U.
      • Bubalo G.
      • et al.
      Novel signalling mechanisms and targets in renal ischaemia and reperfusion injury.
      Immunohistochemistry was performed to determine whether diosmetin suppressed the expression and subcellular localization of p65 after I/R. The results showed that p65 expression was markedly increased after 24 h of reperfusion. However, p65 expression showed a dose-dependent decrease in the pretreatment groups (Fig. 3A and B). Moreover, p65 nuclear staining indicated that p65 was translocated into the nucleus in response to I/R injury (Fig. 3A). To further explore the NF-κB pathway, p65, phosphorylated-p65, IκBα, and phosphorylated-IκBα were examined by Western blotting (Fig. 3C). I/R increased the protein levels of p65, p-p65, and p-IκBα and decreased the expression of IκBα compared with sham mice, whereas diosmetin reversed these trends (Fig. 3D-G). In addition, to test whether diosmetin suppressed expression of downstream inflammatory cytokines, real-time PCR (RT-PCR) was used to detect the expression of IL-1β, IL-6 and TNF-α in five groups (Fig. 3H). Interestingly, diosmetin did produce markedly change with a significantly dose-dependent decrease in these inflammation mediators when compared with I/R injury mice. Together, these results suggest that diosmetin might be capable of protecting the kidneys from I/R induced injury, in part through inhibiting the NF-κB signaling pathway and attenuating the inflammatory response.
      Figure thumbnail gr3
      Fig. 3Diosmetin suppresses the NF-κB signaling pathway after renal I/R injury. (A) Representative images of immunohistochemical staining of p65 in kidneys from different groups. Magnification: 400×. Bar = 100 μm. Red arrow denotes p65 staining of a nucleus. (B) Quantitative assessment of p65 expression in the kidney. (C) Western blotting showed protein levels of p65, phosphorylated-p65 (p-p65), IκBα, and phosphorylated-IκBα (p-IκBα). GAPDH was used as a loading control. (D-G) Quantification of NF-κB pathway-related proteins. (H) Real-time qPCR analysis of inflammatory cytokines following I/R. Values are expressed as the mean ± SE (n = 6 mice each group).P < 0.05 versus sham; #P < 0.05 versus I/R. SE = standard error; qPCR = quantitative polymerase chain reaction; GAPDH = glyceraldehyde-3-phosphate dehydrogenase. (Color version of figure is available online.)

      Diosmetin alleviates apoptosis after renal I/R injury

      To determine whether diosmetin reduced renal cell apoptosis after I/R injury, a TUNEL assay was used to identify apoptotic cells (Fig. 4A). In the I/R group, an increase in TUNEL-positive cells was observed compared with the sham group, whereas preconditioning with 1 mg/kg diosmetin resulted in a significant reduction in the number of apoptotic cells (5.14 ± 3.33 % versus 60.77 ± 13.52 %, P < 0.05; Fig. 4B). To further explore the potential mechanisms of apoptosis, we performed with Western blotting to test protein expression levels of PARP-1, cleaved caspase 3, Bcl-2, and Bax (Fig. 4C). The results indicated that I/R resulted in significant upregulation of PARP-1 and cleaved caspase 3 expression and downregulation of the ratio of Bcl-2/Bax compared with the sham group. In contrast, preconditioning with diosmetin reversed these changes in a dose-dependent manner (Fig. 4D-F), indicating that diosmetin could have a potential effect on ameliorating I/R-induced cellular apoptosis through suppression of the mitochondrial apoptosis pathway.
      Figure thumbnail gr4
      Fig. 4Diosmetin attenuates I/R-induced apoptosis. (A) Representative photomicrographs of TUNEL staining taken from five different treatments after 24 h of reperfusion. Magnification: 400×. Bar = 100 μm. TUNEL-positive cells are stained brown (red arrow). (B) TUNEL-positive cells were quantitatively analyzed and expressed as a percentage of positive cells in the high-power field. (C) Western blot bands displayed apoptotic-related protein expression of PARP-1, cleaved-caspase 3, Bcl-2, and Bax in five groups. (D-F) Representative quantitative analysis of apoptotic protein levels (n = 6 mice per group). Data are presented as the mean ± SE.P < 0.05 versus sham; #P < 0.05 versus I/R. SE = standard error. (Color version of figure is available online.)

      Diosmetin prevents renal oxidative stress and activates the Nrf2 signaling pathway after I/R injury

      Renal malondialdehyde levels were examined to evaluate the antioxidant effect of diosmetin. The results showed that renal malondialdehyde was significantly increased in the I/R group when compared with the sham group (1.92 ± 0.13 versus 8.02 ± 0.68 nm/mg protein, P < 0.05, Fig. 5A). However, there were significant decreases in the I/R + 0.25 mg/kg diosmetin, I/R + 0. 5 mg/kg diosmetin, and I/R + 1 mg/kg diosmetin groups when compared with the I/R group (5.54 ± 0.43, 4.06 ± 0.54, and 2.28 ± 0.41 nm/mg protein, #P < 0.05). Because Nrf2 plays an important role in regulating the antioxidant response,
      • Liu M.
      • Grigoryev D.N.
      • Crow M.T.
      • et al.
      Transcription factor Nrf2 is protective during ischemic and nephrotoxic acute kidney injury in mice.
      Western blotting was performed to identify the effect of diosmetin on nuclear expression levels of Nrf2 and downstream proteins HO-1 and NQO-1 (Fig. 5B). Compared with the sham group, I/R injury mice experienced an increase in Nrf2, HO-1 and NQO-1 expression. In addition, preconditioning with diosmetin significantly augmented the expression of these proteins (Fig. 5C-E). Interestingly, similar results were observed in the mRNA levels of HO-1 and NQO-1 genes, respectively (Fig. 5F and G), which implied that the Nrf2/HO-1 signaling pathway was activated by diosmetin.
      Figure thumbnail gr5
      Fig. 5Diosmetin upregulates the Nrf2 signaling pathway–induced by I/R injury. (A) Representative MDA levels of kidneys from different groups. (B) Representative Western blots of Nrf2 in the nucleus, and HO-1 and NQO-1 in the kidneys. Histone and β-actin served as loading controls, respectively. (C-E) Quantitative analysis of the expressive levels of Nrf2, HO-1, and NQO-1. (F, G) Expression levels of HO-1 and NQO-1 were evaluated by RT-qPCR after I/R injury. Data are presented as the mean ± SE (n = 6 mice per group).P < 0.05 versus sham; #P < 0.05 versus I/R. MDA = malondialdehyde; SE = standard error.

      Discussion

      Renal I/R injury is a difficult and complex clinical problem. Due to limited treatment options for patients, renal I/R injury has adverse outcomes that increase the risk of mortality.
      • Lameire N.H.
      • Bagga A.
      • Cruz D.
      • et al.
      Acute kidney injury: an increasing global concern.
      It has been reported that renal I/R injury was a predominant cause of AKI, resulting in renal tubule dilation, inflammatory insult, apoptotic cell death, and ultimately renal failure.
      • El Sabbahy M.
      • Vaidya V.S.
      Ischemic kidney injury and mechanisms of tissue repair.
      Thus, looking for new pharmacologic agents is an essential tactic to preclude renal I/R injury.
      Diosmetin has been reported to exhibit beneficial effects on diverse experimental models through its suppression of inflammation, oxidative stress, and apoptosis.
      • Yu G.
      • Wan R.
      • Yin G.
      • et al.
      Diosmetin ameliorates the severity of cerulein-induced acute pancreatitis in mice by inhibiting the activation of the nuclear factor-kappaB.
      • Shen Z.
      • Shao J.
      • Dai J.
      • et al.
      Diosmetin protects against retinal injury via reduction of DNA damage and oxidative stress.
      Yu et al.
      • Yu G.
      • Wan R.
      • Yin G.
      • et al.
      Diosmetin ameliorates the severity of cerulein-induced acute pancreatitis in mice by inhibiting the activation of the nuclear factor-kappaB.
      reported that the protective effects of diosmetin could suppress the translocation of p65, reduce the release of proinflammatory cytokines, and impair the severity of cerulein-induced acute pacreatitis biochemically and morphologically. The properties of antioxidative stress have been shown to decrease the levels of reactive oxidant species and glutathione.
      • Shen Z.
      • Shao J.
      • Dai J.
      • et al.
      Diosmetin protects against retinal injury via reduction of DNA damage and oxidative stress.
      Another study showed that diosmetin could decrease cell death in the thymus via suppression of Fas/FasL-dependent pathways.
      • Zhao R.
      • Chen Z.
      • Jia G.
      • et al.
      Protective effects of diosmetin extracted from Galium verum L. on the thymus of U14-bearing mice.
      Nevertheless, how diosmetin benefits the kidney has not been reported previously.
      In the present study, three doses (0.25, 0.5, and 1 mg/kg) of diosmetin were used to determine its effect on renal I/R injury. Renal morphologic structures displayed tubular hemorrhaging, epithelial cell cataplasia and necrosis from I/R mice, suggesting that renal I/R could result in the destruction of renal tissues. The data showed that diosmetin prevents this destruction in a dose-dependent manner; however, further beneficial effects were not shown with increasing concentrations. We then explored the potential mechanisms of diosmetin protection against renal I/R injury. The results showed that diosmetin alleviated inflammatory response, cellular apoptosis, and promoted potential capacity of antioxidative stress with preconditioning. The underlying mechanisms of renoprotection are mainly due to the repression of NF-κB and apoptosis signaling, as well as activation of Nrf2/HO-1 signaling.
      It is well known that members of the NF-κB family play an important role in regulating inflammation.
      • Vallabhapurapu S.
      • Karin M.
      Regulation and function of NF-kappaB transcription factors in the immune system.
      The crucial subunit p65 of the NF-κB pathway is normally deactivated in the cytoplasm by integration with IκBs. During renal I/R injury, IκBs is phosphorylated and triggers ubiquitin-dependent IκBα degradation, allowing for p65 translocation into the nucleus to upregulate proinflammation-related mediators.
      • Kusch A.
      • Hoff U.
      • Bubalo G.
      • et al.
      Novel signalling mechanisms and targets in renal ischaemia and reperfusion injury.
      Consistent with previous studies,
      • Yu G.
      • Wan R.
      • Yin G.
      • et al.
      Diosmetin ameliorates the severity of cerulein-induced acute pancreatitis in mice by inhibiting the activation of the nuclear factor-kappaB.
      • Ge A.
      • Liu Y.
      • Zeng X.
      • et al.
      Effect of diosmetin on airway remodeling in a murine model of chronic asthma.
      the expression of p-IκBα, p65, and p-p65 was elevated and IκBα levels were reduced in the I/R mice. Similarly, ischemia increased the mRNA expression levels of NF-κB pathway-targeted genes, including IL-1β, IL-6, and TNF-α. Nevertheless, preadministration with diosmetin effectively reversed these changes, demonstrating that activation of the NF-κB pathway correlated with renal I/R injury in mice. Diosmetin had a renoprotective effect through suppression of the NF-κB pathway.
      Inflammation is also an important contributor to the progression of cellular apoptosis.
      • Lee H.T.
      • Gallos G.
      • Nasr S.H.
      • et al.
      A1 adenosine receptor activation inhibits inflammation, necrosis, and apoptosis after renal ischemia-reperfusion injury in mice.
      The translocation of p65 into the nucleus upregulates TNF-α expression, a proapoptotic gene, which causes tubular endothelial cell death through caspase-3.
      • Li J.
      • Hong Z.
      • Liu H.
      • et al.
      Hydrogen-rich saline promotes the recovery of renal function after ischemia/reperfusion injury in rats via anti-apoptosis and anti-inflammation.
      Activated caspase-3 facilitates PARP-1 expression, which can be involved in the recovery of DNA damage. However, excessive PARP-1 activation can result in cell death by depletion of intracellular adenosine triphosphate in tubular cells.
      • Skaper S.D.
      Poly(ADP-Ribose) polymerase-1 in acute neuronal death and inflammation: a strategy for neuroprotection.
      • Thiemermann C.
      • Bowes J.
      • Myint F.P.
      • et al.
      Inhibition of the activity of poly(ADP ribose) synthetase reduces ischemia-reperfusion injury in the heart and skeletal muscle.
      At the cellular level, diosmetin antagonized the damage of the mitochondrial membrane and protected retinal injury from mitochondrial-associated apoptosis.
      • Shen Z.
      • Shao J.
      • Dai J.
      • et al.
      Diosmetin protects against retinal injury via reduction of DNA damage and oxidative stress.
      Likewise, data from our present study showed that the expression of TNF-α, cleaved caspase 3, and PARP-1 were markedly increased in the I/R group. However, diosmetin reversed these trends (Fig. 3, Fig. 4), suggesting the effect of antiapoptosis via reducing the mRNA expression levels of TNF-α, subsequently preventing mitochondrial apoptotic pathway regulated by members of the Bcl-2 protein family and then downregulating the downstream protein levels of cleaved capspase 3 and PARP-1.
      However, other studies have shown contrary results. Liu et al.
      • Liu B.
      • Shi Y.
      • Peng W.
      • et al.
      Diosmetin induces apoptosis by upregulating p53 via the TGF-beta signal pathway in HepG2 hepatoma cells.
      reported that diosmetin was capable of promoting expression of p53 and increasing the ratio of Bcl-2/Bax proteins, leading to hepatocellular carcinoma apoptosis in vitro. Similar results were observed in renal cell carcinoma.
      • Ren Y.
      • Yao X.
      • Wang X.
      • et al.
      MP85–12 diosmetin enhances trail-induced apoptosis in renal carcinoma cells through the up-regulation of death receptor 5.
      We provided evidence that diosmetin resulted in antiapoptotic effects in an animal model, with less renal tubule injury and a decreased Bcl-2/Bax ratio. Likewise, Shen et al.
      • Shen Z.
      • Shao J.
      • Dai J.
      • et al.
      Diosmetin protects against retinal injury via reduction of DNA damage and oxidative stress.
      demonstrated that diosmetin reduced the expression of Bcl-2/Bax. It is well established that p53 negatively regulates proapoptosis by inhibiting the cell cycle to suppress tumor growth.
      • Liao J.M.
      • Cao B.
      • Deng J.
      • et al.
      TFIIS.h, a new target of p53, regulates transcription efficiency of pro-apoptotic bax gene.
      Obviously, p53 is extensively activated in response to strong stress such as oncogenic progression, participating in accelerating tumor cell death through activating mitochondrial apoptotic proteins. By contrast, p53 is slightly activated in response to low stressors, such as I/R, to provide restored function to the injury.
      • Vousden K.H.
      • Lane D.P.
      p53 in health and disease.
      Furthermore, since mitochondrial apoptotic pathway plays an important role in the apoptotic progression of renal I/R injury,
      • Castaneda M.P.
      • Swiatecka-Urban A.
      • Mitsnefes M.M.
      • et al.
      Activation of mitochondrial apoptotic pathways in human renal allografts after ischemiareperfusion injury.
      • Supavekin S.
      • Zhang W.
      • Kucherlapati R.
      • et al.
      Differential gene expression following early renal ischemia/reperfusion.
      we speculated that the renoprotection of diosmetin might be via inhibiting of mitochondrial apoptotic pathway. Indeed, diosmetin increased the ratio of Bcl-2/Bax after renal I/R and decreased cleaved caspase-3 and PARP-1. Nevertheless, our experiment was performed with mouse model, and a study about the exact mechanism is needed to further research.
      Nrf2, a redox-sensitive transcription factor, is responsible for upregulating target genes encoding phase II detoxifying enzymes and antioxidants that maintain cellular redox homeostasis.
      • Jiang T.
      • Tian F.
      • Zheng H.
      • et al.
      Nrf2 suppresses lupus nephritis through inhibition of oxidative injury and the NF-kappaB-mediated inflammatory response.
      Crosstalk of the NF-κB and Nrf2/HO-1 pathways has been comprehensively researched. Li et al.
      • Li W.
      • Khor T.O.
      • Xu C.
      • et al.
      Activation of Nrf2-antioxidant signaling attenuates NFkappaB-inflammatory response and elicits apoptosis.
      indicated that activation of the Nrf2 antioxidant pathway resulted in the reduction of NF-κB-mediated inflammation. Jiang et al.
      • Jiang T.
      • Tian F.
      • Zheng H.
      • et al.
      Nrf2 suppresses lupus nephritis through inhibition of oxidative injury and the NF-kappaB-mediated inflammatory response.
      reported that knockdown of Nrf2 expression stimulated the NF-κB-mediated inflammatory response compared with normal mouse models of lupus nephritis. Several chemicals were shown to be beneficial by elevating the Nrf2 protein level and repressing the expression of NF-κB and downstream cytokines.
      • Mahmoud-Awny M.
      • Attia A.S.
      • Abd-Ellah M.F.
      • et al.
      Mangiferin mitigates gastric ulcer in ischemia/reperfused rats: involvement of PPAR-gamma, NF-kappaB and Nrf2/HO-1 signaling pathways.
      • Farias J.G.
      • Carrasco-Pozo C.
      • Carrasco Loza R.
      • et al.
      Polyunsaturated fatty acid induces cardioprotection against ischemia-reperfusion through the inhibition of NF-kappaB and induction of Nrf2.
      • Sriram N.
      • Kalayarasan S.
      • Sudhandiran G.
      Epigallocatechin-3-gallate augments antioxidant activities and inhibits inflammation during bleomycin-induced experimental pulmonary fibrosis through Nrf2-Keap1 signaling.
      Consistent with previous research, I/R in murine kidneys led to increased Nrf2 accumulation in the nucleus, concomitant with elevation of its downstream target genes HO-1 and NQO-1 at the mRNA and protein levels. Diosmetin augmented these trends dramatically with preconditioning. Accordingly, the results from our study demonstrate the potential renoprotective mechanism of diosmetin through Nrf2/HO-1 pathway activation and suppression of NF-κB signaling.
      Inflammation and oxidative stress are two major components involved in the pathogenesis and progression of AKI. NF-κB and Nrf2 are the crucial transcription factors that regulate cellular responses to inflammation and oxidative stress, respectively, after AKI. Nrf2 activation can reduce NF-κB activity, resulting in decreased cytokine production, whereas NF-κB can modulate Nrf2 transcription and activity, having both positive and negative effects on Nrf2 target gene expression. There is a delicate balance between inflammation-induced cellular apoptosis and enhanced antioxidant defense capacity mediated by Nrf2 in this process. Diosmetin tips the balance in favor of recovering from I/R-induced acute renal injury by suppressing the NF-κB pathway and boosting the Nrf2/HO-1 axis (Fig. 6).
      Figure thumbnail gr6
      Fig. 6Proposed scheme for the balance between NF-κB and Nrf2 and the protective effect of diosmetin on I/R-induced acute renal injury. On the one hand, diosmetin prevents NF-κB activation, reduces inflammatory gene expression, and subsequently blocks the mitochondrial apoptotic pathway. Then, diosmetin inhibits the downstream proteins cleaved caspase 3 and PARP-1. On the other hand, diosmetin increases the accumulation of Nrf2 in the nucleus and promotes its downstream target gene expression and eventually enhancing antioxidant activity. (Color version of figure is available online.)
      Overall, this study demonstrates that diosmetin can protect mice against renal I/R injury by suppressing inflammation and apoptosis and enhancing antioxidant capabilities. The mechanisms of renoprotection are linked with suppression of NF-κB and the mitochondrial pathways associated with Nrf2/HO-1 signaling. Our results suggest that diosmetin may be a promising therapeutic for preventing renal I/R injury.

      Acknowledgment

      This work was supported by the National Natural Science Foundation of China , No. 81100281 , and the Hubei Province health and family planning scientific research project, No. WJ2015XB018.
      Authors' contributions: W-F.H. obtained the funding. W-F.H. and K.Y. contributed to the conception and/or design of this study. K.Y. and W-F.L. conducted the experiments. K.Y., W-F.L., J-F.Y., and C.Y. performed the data analysis. K.Y. and W-F.H. wrote and/or revised the article. K.Y., W-F.L., J-F.Y., C.Y., and W-F.H. contributed to final approval of the article.

      Disclosure

      The authors reported no proprietary or commercial interest in any product mentioned or concept discussed in this article.

      References

        • Lameire N.H.
        • Bagga A.
        • Cruz D.
        • et al.
        Acute kidney injury: an increasing global concern.
        Lancet. 2013; 382: 170-179
        • Murugan R.
        • Kellum J.A.
        Acute kidney injury: what's the prognosis?.
        Nat Rev Nephrol. 2011; 7: 209-217
        • Andreucci M.
        • Faga T.
        • Pisani A.
        • et al.
        Acute kidney injury by radiographic contrast media: pathogenesis and prevention.
        Biomed Res Int. 2014; 2014: 362725
        • Bellomo R.
        • Kellum J.A.
        • Ronco C.
        Acute kidney injury.
        Lancet. 2012; 380: 756-766
        • Bonventre J.V.
        • Yang L.
        Cellular pathophysiology of ischemic acute kidney injury.
        J Clin Invest. 2011; 121: 4210-4221
        • Tak P.P.
        • Firestein G.S.
        NF-kappaB: a key role in inflammatory diseases.
        J Clin Invest. 2001; 107: 7-11
        • Kanagasundaram N.S.
        Pathophysiology of ischaemic acute kidney injury.
        Ann Clin Biochem. 2015; 52: 193-205
        • Ramachandran S.
        • Liaw J.M.
        • Jia J.
        • et al.
        Ischemia-reperfusion injury in rat steatotic liver is dependent on NFkappaB P65 activation.
        Transpl Immunol. 2012; 26: 201-206
        • Ghosh S.
        • Hayden M.S.
        New regulators of NF-kappaB in inflammation.
        Nat Rev Immunol. 2008; 8: 837-848
        • Martinon F.
        • Holler N.
        • Richard C.
        • et al.
        Activation of a pro-apoptotic amplification loop through inhibition of NF-κB-dependent survival signals by caspase-mediated inactivation of RIP.
        FEBS Lett. 2000; 468: 134-136
        • Lin M.
        • Li L.
        • Li L.
        • et al.
        The protective effect of baicalin against renal ischemia-reperfusion injury through inhibition of inflammation and apoptosis.
        BMC Complement Altern Med. 2014; 14: 19
        • Ka S.O.
        • Hwang H.P.
        • Jang J.H.
        • et al.
        The protein kinase 2 inhibitor tetrabromobenzotriazole protects against renal ischemia reperfusion injury.
        Sci Rep. 2015; 5: 14816
        • Guo S.X.
        • Fang Q.
        • You C.G.
        • et al.
        Effects of hydrogen-rich saline on early acute kidney injury in severely burned rats by suppressing oxidative stress induced apoptosis and inflammation.
        J Transl Med. 2015; 13: 183
        • Jiang T.
        • Tian F.
        • Zheng H.
        • et al.
        Nrf2 suppresses lupus nephritis through inhibition of oxidative injury and the NF-kappaB-mediated inflammatory response.
        Kidney Int. 2014; 85: 333-343
        • Shelton L.M.
        • Park B.K.
        • Copple I.M.
        Role of Nrf2 in protection against acute kidney injury.
        Kidney Int. 2013; 84: 1090-1095
        • Mahmoud-Awny M.
        • Attia A.S.
        • Abd-Ellah M.F.
        • et al.
        Mangiferin mitigates gastric ulcer in ischemia/reperfused rats: involvement of PPAR-gamma, NF-kappaB and Nrf2/HO-1 signaling pathways.
        PLoS One. 2015; 10: e0132497
        • Li W.
        • Suwanwela N.C.
        • Patumraj S.
        Curcumin by down-regulating NF-kB and elevating Nrf2, reduces brain edema and neurological dysfunction after cerebral I/R.
        Microvasc Res. 2016; 106: 117-127
        • Farias J.G.
        • Carrasco-Pozo C.
        • Carrasco Loza R.
        • et al.
        Polyunsaturated fatty acid induces cardioprotection against ischemia-reperfusion through the inhibition of NF-kappaB and induction of Nrf2.
        Exp Biol Med (Maywood). 2016; : 1-11
        • Hua K.
        • Sheng X.
        • Li T.T.
        • et al.
        The edaravone and 3-n-butylphthalide ring-opening derivative 10b effectively attenuates cerebral ischemia injury in rats.
        Acta Pharmacol Sin. 2015; 36: 917-927
        • Rao J.
        • Qian X.
        • Li G.
        • et al.
        ATF3-mediated NRF2/HO-1 signaling regulates TLR4 innate immune responses in mouse liver ischemia/reperfusion injury.
        Am J Transplant. 2015; 15: 76-87
        • Zhao R.
        • Chen Z.
        • Jia G.
        • et al.
        Protective effects of diosmetin extracted from Galium verum L. on the thymus of U14-bearing mice.
        Can J Physiol Pharmacol. 2011; 89: 665-673
        • Yu G.
        • Wan R.
        • Yin G.
        • et al.
        Diosmetin ameliorates the severity of cerulein-induced acute pancreatitis in mice by inhibiting the activation of the nuclear factor-kappaB.
        Int J Clin Exp Pathol. 2014; 7: 2133-2142
        • Ge A.
        • Liu Y.
        • Zeng X.
        • et al.
        Effect of diosmetin on airway remodeling in a murine model of chronic asthma.
        Acta Biochim Biophys Sin (Shanghai). 2015; 47: 604-611
        • Liu J.
        • Wen X.
        • Liu B.
        • et al.
        Diosmetin inhibits the metastasis of hepatocellular carcinoma cells by downregulating the expression levels of MMP2 and MMP9.
        Mol Med Rep. 2016; 13: 2401-2408
        • Liu B.
        • Shi Y.
        • Peng W.
        • et al.
        Diosmetin induces apoptosis by upregulating p53 via the TGF-beta signal pathway in HepG2 hepatoma cells.
        Mol Med Rep. 2016; 14: 159-164
        • Ren Y.
        • Yao X.
        • Wang X.
        • et al.
        MP85–12 diosmetin enhances trail-induced apoptosis in renal carcinoma cells through the up-regulation of death receptor 5.
        J Urol. 2016; 195: e1102
        • Shen Z.
        • Shao J.
        • Dai J.
        • et al.
        Diosmetin protects against retinal injury via reduction of DNA damage and oxidative stress.
        Toxicol Rep. 2016; 3: 78-86
        • Kim M.
        • Kim M.
        • Kim N.
        • et al.
        Isoflurane mediates protection from renal ischemia-reperfusion injury via sphingosine kinase and sphingosine-1-phosphate-dependent pathways.
        Am J Physiol Renal Physiol. 2007; 293: F1827-F1835
        • Ham A.
        • Rabadi M.
        • Kim M.
        • et al.
        Peptidyl arginine deiminase-4 activation exacerbates kidney ischemia-reperfusion injury.
        Am J Physiol Renal Physiol. 2014; 307: F1052-F1062
        • Kusch A.
        • Hoff U.
        • Bubalo G.
        • et al.
        Novel signalling mechanisms and targets in renal ischaemia and reperfusion injury.
        Acta Physiol (Oxf). 2013; 208: 25-40
        • Liu M.
        • Grigoryev D.N.
        • Crow M.T.
        • et al.
        Transcription factor Nrf2 is protective during ischemic and nephrotoxic acute kidney injury in mice.
        Kidney Int. 2009; 76: 277-285
        • El Sabbahy M.
        • Vaidya V.S.
        Ischemic kidney injury and mechanisms of tissue repair.
        Wiley Interdiscip Rev Syst Biol Med. 2011; 3: 606-618
        • Vallabhapurapu S.
        • Karin M.
        Regulation and function of NF-kappaB transcription factors in the immune system.
        Annu Rev Immunol. 2009; 27: 693-733
        • Lee H.T.
        • Gallos G.
        • Nasr S.H.
        • et al.
        A1 adenosine receptor activation inhibits inflammation, necrosis, and apoptosis after renal ischemia-reperfusion injury in mice.
        J Am Soc Nephrol. 2004; 15: 102-111
        • Li J.
        • Hong Z.
        • Liu H.
        • et al.
        Hydrogen-rich saline promotes the recovery of renal function after ischemia/reperfusion injury in rats via anti-apoptosis and anti-inflammation.
        Front Pharmacol. 2016; 7: 106
        • Skaper S.D.
        Poly(ADP-Ribose) polymerase-1 in acute neuronal death and inflammation: a strategy for neuroprotection.
        Ann N Y Acad Sci. 2003; 993 (discussion 287-218): 217-228
        • Thiemermann C.
        • Bowes J.
        • Myint F.P.
        • et al.
        Inhibition of the activity of poly(ADP ribose) synthetase reduces ischemia-reperfusion injury in the heart and skeletal muscle.
        Proc Natl Acad Sci U S A. 1997; 94: 679-683
        • Liao J.M.
        • Cao B.
        • Deng J.
        • et al.
        TFIIS.h, a new target of p53, regulates transcription efficiency of pro-apoptotic bax gene.
        Sci Rep. 2016; 6: 23542
        • Vousden K.H.
        • Lane D.P.
        p53 in health and disease.
        Nat Rev Mol Cell Biol. 2007; 8: 275-283
        • Castaneda M.P.
        • Swiatecka-Urban A.
        • Mitsnefes M.M.
        • et al.
        Activation of mitochondrial apoptotic pathways in human renal allografts after ischemiareperfusion injury.
        Transplantation. 2003; 76: 50-54
        • Supavekin S.
        • Zhang W.
        • Kucherlapati R.
        • et al.
        Differential gene expression following early renal ischemia/reperfusion.
        Kidney Int. 2003; 63: 1714-1724
        • Li W.
        • Khor T.O.
        • Xu C.
        • et al.
        Activation of Nrf2-antioxidant signaling attenuates NFkappaB-inflammatory response and elicits apoptosis.
        Biochem Pharmacol. 2008; 76: 1485-1489
        • Sriram N.
        • Kalayarasan S.
        • Sudhandiran G.
        Epigallocatechin-3-gallate augments antioxidant activities and inhibits inflammation during bleomycin-induced experimental pulmonary fibrosis through Nrf2-Keap1 signaling.
        Pulm Pharmacol Ther. 2009; 22: 221-236